ID: 907932725

View in Genome Browser
Species Human (GRCh38)
Location 1:59015538-59015560
Sequence ACATGGGCCTCTCTTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907932725_907932730 -7 Left 907932725 1:59015538-59015560 CCTGTTTCAAGAGAGGCCCATGT No data
Right 907932730 1:59015554-59015576 CCCATGTGGGGATGTGCTCGTGG No data
907932725_907932733 2 Left 907932725 1:59015538-59015560 CCTGTTTCAAGAGAGGCCCATGT No data
Right 907932733 1:59015563-59015585 GGATGTGCTCGTGGTGATGAGGG No data
907932725_907932734 13 Left 907932725 1:59015538-59015560 CCTGTTTCAAGAGAGGCCCATGT No data
Right 907932734 1:59015574-59015596 TGGTGATGAGGGTGAACACATGG No data
907932725_907932732 1 Left 907932725 1:59015538-59015560 CCTGTTTCAAGAGAGGCCCATGT No data
Right 907932732 1:59015562-59015584 GGGATGTGCTCGTGGTGATGAGG No data
907932725_907932735 30 Left 907932725 1:59015538-59015560 CCTGTTTCAAGAGAGGCCCATGT No data
Right 907932735 1:59015591-59015613 ACATGGCTTCCAGCATTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907932725 Original CRISPR ACATGGGCCTCTCTTGAAAC AGG (reversed) Intergenic
No off target data available for this crispr