ID: 907932733

View in Genome Browser
Species Human (GRCh38)
Location 1:59015563-59015585
Sequence GGATGTGCTCGTGGTGATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907932723_907932733 12 Left 907932723 1:59015528-59015550 CCTTACTGAGCCTGTTTCAAGAG No data
Right 907932733 1:59015563-59015585 GGATGTGCTCGTGGTGATGAGGG No data
907932725_907932733 2 Left 907932725 1:59015538-59015560 CCTGTTTCAAGAGAGGCCCATGT No data
Right 907932733 1:59015563-59015585 GGATGTGCTCGTGGTGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907932733 Original CRISPR GGATGTGCTCGTGGTGATGA GGG Intergenic
No off target data available for this crispr