ID: 907932734

View in Genome Browser
Species Human (GRCh38)
Location 1:59015574-59015596
Sequence TGGTGATGAGGGTGAACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907932723_907932734 23 Left 907932723 1:59015528-59015550 CCTTACTGAGCCTGTTTCAAGAG No data
Right 907932734 1:59015574-59015596 TGGTGATGAGGGTGAACACATGG No data
907932731_907932734 -4 Left 907932731 1:59015555-59015577 CCATGTGGGGATGTGCTCGTGGT No data
Right 907932734 1:59015574-59015596 TGGTGATGAGGGTGAACACATGG No data
907932725_907932734 13 Left 907932725 1:59015538-59015560 CCTGTTTCAAGAGAGGCCCATGT No data
Right 907932734 1:59015574-59015596 TGGTGATGAGGGTGAACACATGG No data
907932729_907932734 -3 Left 907932729 1:59015554-59015576 CCCATGTGGGGATGTGCTCGTGG No data
Right 907932734 1:59015574-59015596 TGGTGATGAGGGTGAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907932734 Original CRISPR TGGTGATGAGGGTGAACACA TGG Intergenic
No off target data available for this crispr