ID: 907933792

View in Genome Browser
Species Human (GRCh38)
Location 1:59023911-59023933
Sequence CAAATTATGAGACATAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907933791_907933792 18 Left 907933791 1:59023870-59023892 CCATAATTTTATGTTTTTATAAG No data
Right 907933792 1:59023911-59023933 CAAATTATGAGACATAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907933792 Original CRISPR CAAATTATGAGACATAAATC AGG Intergenic
No off target data available for this crispr