ID: 907935013

View in Genome Browser
Species Human (GRCh38)
Location 1:59034107-59034129
Sequence TGTCCTCATTGGAGCAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907935013_907935016 0 Left 907935013 1:59034107-59034129 CCTTCTTTGCTCCAATGAGGACA No data
Right 907935016 1:59034130-59034152 GGTGCATCTGCCAGAAAACATGG No data
907935013_907935018 12 Left 907935013 1:59034107-59034129 CCTTCTTTGCTCCAATGAGGACA No data
Right 907935018 1:59034142-59034164 AGAAAACATGGCACCTTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907935013 Original CRISPR TGTCCTCATTGGAGCAAAGA AGG (reversed) Intergenic
No off target data available for this crispr