ID: 907936054

View in Genome Browser
Species Human (GRCh38)
Location 1:59043323-59043345
Sequence GTCTTTTCTTCCTTCCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907936054_907936056 5 Left 907936054 1:59043323-59043345 CCCATGGGGAAGGAAGAAAAGAC No data
Right 907936056 1:59043351-59043373 TTATTACTGTTATTATTCCCTGG No data
907936054_907936060 28 Left 907936054 1:59043323-59043345 CCCATGGGGAAGGAAGAAAAGAC No data
Right 907936060 1:59043374-59043396 TACCTATATACAAAAGGAGTTGG No data
907936054_907936058 22 Left 907936054 1:59043323-59043345 CCCATGGGGAAGGAAGAAAAGAC No data
Right 907936058 1:59043368-59043390 CCCTGGTACCTATATACAAAAGG No data
907936054_907936061 29 Left 907936054 1:59043323-59043345 CCCATGGGGAAGGAAGAAAAGAC No data
Right 907936061 1:59043375-59043397 ACCTATATACAAAAGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907936054 Original CRISPR GTCTTTTCTTCCTTCCCCAT GGG (reversed) Intergenic
No off target data available for this crispr