ID: 907936055

View in Genome Browser
Species Human (GRCh38)
Location 1:59043324-59043346
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907936055_907936060 27 Left 907936055 1:59043324-59043346 CCATGGGGAAGGAAGAAAAGACA No data
Right 907936060 1:59043374-59043396 TACCTATATACAAAAGGAGTTGG No data
907936055_907936058 21 Left 907936055 1:59043324-59043346 CCATGGGGAAGGAAGAAAAGACA No data
Right 907936058 1:59043368-59043390 CCCTGGTACCTATATACAAAAGG No data
907936055_907936061 28 Left 907936055 1:59043324-59043346 CCATGGGGAAGGAAGAAAAGACA No data
Right 907936061 1:59043375-59043397 ACCTATATACAAAAGGAGTTGGG No data
907936055_907936056 4 Left 907936055 1:59043324-59043346 CCATGGGGAAGGAAGAAAAGACA No data
Right 907936056 1:59043351-59043373 TTATTACTGTTATTATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907936055 Original CRISPR TGTCTTTTCTTCCTTCCCCA TGG (reversed) Intergenic