ID: 907936056

View in Genome Browser
Species Human (GRCh38)
Location 1:59043351-59043373
Sequence TTATTACTGTTATTATTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907936055_907936056 4 Left 907936055 1:59043324-59043346 CCATGGGGAAGGAAGAAAAGACA No data
Right 907936056 1:59043351-59043373 TTATTACTGTTATTATTCCCTGG No data
907936054_907936056 5 Left 907936054 1:59043323-59043345 CCCATGGGGAAGGAAGAAAAGAC No data
Right 907936056 1:59043351-59043373 TTATTACTGTTATTATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907936056 Original CRISPR TTATTACTGTTATTATTCCC TGG Intergenic