ID: 907936058

View in Genome Browser
Species Human (GRCh38)
Location 1:59043368-59043390
Sequence CCCTGGTACCTATATACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907936055_907936058 21 Left 907936055 1:59043324-59043346 CCATGGGGAAGGAAGAAAAGACA No data
Right 907936058 1:59043368-59043390 CCCTGGTACCTATATACAAAAGG No data
907936054_907936058 22 Left 907936054 1:59043323-59043345 CCCATGGGGAAGGAAGAAAAGAC No data
Right 907936058 1:59043368-59043390 CCCTGGTACCTATATACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907936058 Original CRISPR CCCTGGTACCTATATACAAA AGG Intergenic
No off target data available for this crispr