ID: 907936061

View in Genome Browser
Species Human (GRCh38)
Location 1:59043375-59043397
Sequence ACCTATATACAAAAGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907936054_907936061 29 Left 907936054 1:59043323-59043345 CCCATGGGGAAGGAAGAAAAGAC No data
Right 907936061 1:59043375-59043397 ACCTATATACAAAAGGAGTTGGG No data
907936055_907936061 28 Left 907936055 1:59043324-59043346 CCATGGGGAAGGAAGAAAAGACA No data
Right 907936061 1:59043375-59043397 ACCTATATACAAAAGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907936061 Original CRISPR ACCTATATACAAAAGGAGTT GGG Intergenic