ID: 907936691

View in Genome Browser
Species Human (GRCh38)
Location 1:59048147-59048169
Sequence GGTCTCCTGTGGCTCCCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907936683_907936691 -1 Left 907936683 1:59048125-59048147 CCTTCCTCTTTTCCCTCCCTCTG No data
Right 907936691 1:59048147-59048169 GGTCTCCTGTGGCTCCCTGTTGG No data
907936682_907936691 0 Left 907936682 1:59048124-59048146 CCCTTCCTCTTTTCCCTCCCTCT No data
Right 907936691 1:59048147-59048169 GGTCTCCTGTGGCTCCCTGTTGG No data
907936685_907936691 -5 Left 907936685 1:59048129-59048151 CCTCTTTTCCCTCCCTCTGGTCT No data
Right 907936691 1:59048147-59048169 GGTCTCCTGTGGCTCCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907936691 Original CRISPR GGTCTCCTGTGGCTCCCTGT TGG Intergenic
No off target data available for this crispr