ID: 907938506

View in Genome Browser
Species Human (GRCh38)
Location 1:59064707-59064729
Sequence CACTTACTAGGGGGAAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907938506_907938518 24 Left 907938506 1:59064707-59064729 CCAAACTTTCCCCCTAGTAAGTG No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938506_907938514 7 Left 907938506 1:59064707-59064729 CCAAACTTTCCCCCTAGTAAGTG No data
Right 907938514 1:59064737-59064759 GCCCCACAGAAAGATTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907938506 Original CRISPR CACTTACTAGGGGGAAAGTT TGG (reversed) Intergenic