ID: 907938511

View in Genome Browser
Species Human (GRCh38)
Location 1:59064717-59064739
Sequence GGCCATTGCCCACTTACTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907938511_907938514 -3 Left 907938511 1:59064717-59064739 CCCCTAGTAAGTGGGCAATGGCC No data
Right 907938514 1:59064737-59064759 GCCCCACAGAAAGATTAAAGAGG No data
907938511_907938518 14 Left 907938511 1:59064717-59064739 CCCCTAGTAAGTGGGCAATGGCC No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938511_907938519 25 Left 907938511 1:59064717-59064739 CCCCTAGTAAGTGGGCAATGGCC No data
Right 907938519 1:59064765-59064787 GCCCCTATTTGGAAAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907938511 Original CRISPR GGCCATTGCCCACTTACTAG GGG (reversed) Intergenic
No off target data available for this crispr