ID: 907938512

View in Genome Browser
Species Human (GRCh38)
Location 1:59064718-59064740
Sequence GGGCCATTGCCCACTTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907938512_907938519 24 Left 907938512 1:59064718-59064740 CCCTAGTAAGTGGGCAATGGCCC No data
Right 907938519 1:59064765-59064787 GCCCCTATTTGGAAAGCCCCAGG No data
907938512_907938514 -4 Left 907938512 1:59064718-59064740 CCCTAGTAAGTGGGCAATGGCCC No data
Right 907938514 1:59064737-59064759 GCCCCACAGAAAGATTAAAGAGG No data
907938512_907938518 13 Left 907938512 1:59064718-59064740 CCCTAGTAAGTGGGCAATGGCCC No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907938512 Original CRISPR GGGCCATTGCCCACTTACTA GGG (reversed) Intergenic