ID: 907938513

View in Genome Browser
Species Human (GRCh38)
Location 1:59064719-59064741
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907938513_907938514 -5 Left 907938513 1:59064719-59064741 CCTAGTAAGTGGGCAATGGCCCC No data
Right 907938514 1:59064737-59064759 GCCCCACAGAAAGATTAAAGAGG No data
907938513_907938519 23 Left 907938513 1:59064719-59064741 CCTAGTAAGTGGGCAATGGCCCC No data
Right 907938519 1:59064765-59064787 GCCCCTATTTGGAAAGCCCCAGG No data
907938513_907938518 12 Left 907938513 1:59064719-59064741 CCTAGTAAGTGGGCAATGGCCCC No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938513_907938523 30 Left 907938513 1:59064719-59064741 CCTAGTAAGTGGGCAATGGCCCC No data
Right 907938523 1:59064772-59064794 TTTGGAAAGCCCCAGGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907938513 Original CRISPR GGGGCCATTGCCCACTTACT AGG (reversed) Intergenic