ID: 907938514

View in Genome Browser
Species Human (GRCh38)
Location 1:59064737-59064759
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907938512_907938514 -4 Left 907938512 1:59064718-59064740 CCCTAGTAAGTGGGCAATGGCCC No data
Right 907938514 1:59064737-59064759 GCCCCACAGAAAGATTAAAGAGG No data
907938510_907938514 -2 Left 907938510 1:59064716-59064738 CCCCCTAGTAAGTGGGCAATGGC No data
Right 907938514 1:59064737-59064759 GCCCCACAGAAAGATTAAAGAGG No data
907938511_907938514 -3 Left 907938511 1:59064717-59064739 CCCCTAGTAAGTGGGCAATGGCC No data
Right 907938514 1:59064737-59064759 GCCCCACAGAAAGATTAAAGAGG No data
907938506_907938514 7 Left 907938506 1:59064707-59064729 CCAAACTTTCCCCCTAGTAAGTG No data
Right 907938514 1:59064737-59064759 GCCCCACAGAAAGATTAAAGAGG No data
907938513_907938514 -5 Left 907938513 1:59064719-59064741 CCTAGTAAGTGGGCAATGGCCCC No data
Right 907938514 1:59064737-59064759 GCCCCACAGAAAGATTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type