ID: 907938515

View in Genome Browser
Species Human (GRCh38)
Location 1:59064738-59064760
Sequence TCCTCTTTAATCTTTCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907938515_907938523 11 Left 907938515 1:59064738-59064760 CCCCACAGAAAGATTAAAGAGGA No data
Right 907938523 1:59064772-59064794 TTTGGAAAGCCCCAGGTGACTGG No data
907938515_907938519 4 Left 907938515 1:59064738-59064760 CCCCACAGAAAGATTAAAGAGGA No data
Right 907938519 1:59064765-59064787 GCCCCTATTTGGAAAGCCCCAGG No data
907938515_907938518 -7 Left 907938515 1:59064738-59064760 CCCCACAGAAAGATTAAAGAGGA No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907938515 Original CRISPR TCCTCTTTAATCTTTCTGTG GGG (reversed) Intergenic