ID: 907938517

View in Genome Browser
Species Human (GRCh38)
Location 1:59064740-59064762
Sequence TTTCCTCTTTAATCTTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907938517_907938523 9 Left 907938517 1:59064740-59064762 CCACAGAAAGATTAAAGAGGAAA No data
Right 907938523 1:59064772-59064794 TTTGGAAAGCCCCAGGTGACTGG No data
907938517_907938518 -9 Left 907938517 1:59064740-59064762 CCACAGAAAGATTAAAGAGGAAA No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938517_907938519 2 Left 907938517 1:59064740-59064762 CCACAGAAAGATTAAAGAGGAAA No data
Right 907938519 1:59064765-59064787 GCCCCTATTTGGAAAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907938517 Original CRISPR TTTCCTCTTTAATCTTTCTG TGG (reversed) Intergenic
No off target data available for this crispr