ID: 907938518

View in Genome Browser
Species Human (GRCh38)
Location 1:59064754-59064776
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907938517_907938518 -9 Left 907938517 1:59064740-59064762 CCACAGAAAGATTAAAGAGGAAA No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938506_907938518 24 Left 907938506 1:59064707-59064729 CCAAACTTTCCCCCTAGTAAGTG No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938513_907938518 12 Left 907938513 1:59064719-59064741 CCTAGTAAGTGGGCAATGGCCCC No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938512_907938518 13 Left 907938512 1:59064718-59064740 CCCTAGTAAGTGGGCAATGGCCC No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938510_907938518 15 Left 907938510 1:59064716-59064738 CCCCCTAGTAAGTGGGCAATGGC No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938515_907938518 -7 Left 907938515 1:59064738-59064760 CCCCACAGAAAGATTAAAGAGGA No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938511_907938518 14 Left 907938511 1:59064717-59064739 CCCCTAGTAAGTGGGCAATGGCC No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data
907938516_907938518 -8 Left 907938516 1:59064739-59064761 CCCACAGAAAGATTAAAGAGGAA No data
Right 907938518 1:59064754-59064776 AAGAGGAAAAAGCCCCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type