ID: 907938523

View in Genome Browser
Species Human (GRCh38)
Location 1:59064772-59064794
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907938513_907938523 30 Left 907938513 1:59064719-59064741 CCTAGTAAGTGGGCAATGGCCCC No data
Right 907938523 1:59064772-59064794 TTTGGAAAGCCCCAGGTGACTGG No data
907938515_907938523 11 Left 907938515 1:59064738-59064760 CCCCACAGAAAGATTAAAGAGGA No data
Right 907938523 1:59064772-59064794 TTTGGAAAGCCCCAGGTGACTGG No data
907938516_907938523 10 Left 907938516 1:59064739-59064761 CCCACAGAAAGATTAAAGAGGAA No data
Right 907938523 1:59064772-59064794 TTTGGAAAGCCCCAGGTGACTGG No data
907938517_907938523 9 Left 907938517 1:59064740-59064762 CCACAGAAAGATTAAAGAGGAAA No data
Right 907938523 1:59064772-59064794 TTTGGAAAGCCCCAGGTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type