ID: 907944077

View in Genome Browser
Species Human (GRCh38)
Location 1:59117063-59117085
Sequence CAGCCTCCTTCCATTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907944077_907944083 -5 Left 907944077 1:59117063-59117085 CCCAGCCCAATGGAAGGAGGCTG No data
Right 907944083 1:59117081-59117103 GGCTGCAGCCAAGAGCGAAGGGG No data
907944077_907944084 -4 Left 907944077 1:59117063-59117085 CCCAGCCCAATGGAAGGAGGCTG No data
Right 907944084 1:59117082-59117104 GCTGCAGCCAAGAGCGAAGGGGG No data
907944077_907944086 18 Left 907944077 1:59117063-59117085 CCCAGCCCAATGGAAGGAGGCTG No data
Right 907944086 1:59117104-59117126 GCAGTGAGTCACTGCCTTCAAGG No data
907944077_907944082 -6 Left 907944077 1:59117063-59117085 CCCAGCCCAATGGAAGGAGGCTG No data
Right 907944082 1:59117080-59117102 AGGCTGCAGCCAAGAGCGAAGGG No data
907944077_907944081 -7 Left 907944077 1:59117063-59117085 CCCAGCCCAATGGAAGGAGGCTG No data
Right 907944081 1:59117079-59117101 GAGGCTGCAGCCAAGAGCGAAGG No data
907944077_907944087 19 Left 907944077 1:59117063-59117085 CCCAGCCCAATGGAAGGAGGCTG No data
Right 907944087 1:59117105-59117127 CAGTGAGTCACTGCCTTCAAGGG No data
907944077_907944090 26 Left 907944077 1:59117063-59117085 CCCAGCCCAATGGAAGGAGGCTG No data
Right 907944090 1:59117112-59117134 TCACTGCCTTCAAGGGGCGGAGG No data
907944077_907944088 20 Left 907944077 1:59117063-59117085 CCCAGCCCAATGGAAGGAGGCTG No data
Right 907944088 1:59117106-59117128 AGTGAGTCACTGCCTTCAAGGGG No data
907944077_907944089 23 Left 907944077 1:59117063-59117085 CCCAGCCCAATGGAAGGAGGCTG No data
Right 907944089 1:59117109-59117131 GAGTCACTGCCTTCAAGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907944077 Original CRISPR CAGCCTCCTTCCATTGGGCT GGG (reversed) Intergenic
No off target data available for this crispr