ID: 907944079

View in Genome Browser
Species Human (GRCh38)
Location 1:59117068-59117090
Sequence GGCTGCAGCCTCCTTCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907944079_907944086 13 Left 907944079 1:59117068-59117090 CCCAATGGAAGGAGGCTGCAGCC No data
Right 907944086 1:59117104-59117126 GCAGTGAGTCACTGCCTTCAAGG No data
907944079_907944087 14 Left 907944079 1:59117068-59117090 CCCAATGGAAGGAGGCTGCAGCC No data
Right 907944087 1:59117105-59117127 CAGTGAGTCACTGCCTTCAAGGG No data
907944079_907944090 21 Left 907944079 1:59117068-59117090 CCCAATGGAAGGAGGCTGCAGCC No data
Right 907944090 1:59117112-59117134 TCACTGCCTTCAAGGGGCGGAGG No data
907944079_907944083 -10 Left 907944079 1:59117068-59117090 CCCAATGGAAGGAGGCTGCAGCC No data
Right 907944083 1:59117081-59117103 GGCTGCAGCCAAGAGCGAAGGGG No data
907944079_907944089 18 Left 907944079 1:59117068-59117090 CCCAATGGAAGGAGGCTGCAGCC No data
Right 907944089 1:59117109-59117131 GAGTCACTGCCTTCAAGGGGCGG No data
907944079_907944084 -9 Left 907944079 1:59117068-59117090 CCCAATGGAAGGAGGCTGCAGCC No data
Right 907944084 1:59117082-59117104 GCTGCAGCCAAGAGCGAAGGGGG No data
907944079_907944088 15 Left 907944079 1:59117068-59117090 CCCAATGGAAGGAGGCTGCAGCC No data
Right 907944088 1:59117106-59117128 AGTGAGTCACTGCCTTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907944079 Original CRISPR GGCTGCAGCCTCCTTCCATT GGG (reversed) Intergenic
No off target data available for this crispr