ID: 907944080

View in Genome Browser
Species Human (GRCh38)
Location 1:59117069-59117091
Sequence TGGCTGCAGCCTCCTTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907944080_907944088 14 Left 907944080 1:59117069-59117091 CCAATGGAAGGAGGCTGCAGCCA No data
Right 907944088 1:59117106-59117128 AGTGAGTCACTGCCTTCAAGGGG No data
907944080_907944086 12 Left 907944080 1:59117069-59117091 CCAATGGAAGGAGGCTGCAGCCA No data
Right 907944086 1:59117104-59117126 GCAGTGAGTCACTGCCTTCAAGG No data
907944080_907944089 17 Left 907944080 1:59117069-59117091 CCAATGGAAGGAGGCTGCAGCCA No data
Right 907944089 1:59117109-59117131 GAGTCACTGCCTTCAAGGGGCGG No data
907944080_907944090 20 Left 907944080 1:59117069-59117091 CCAATGGAAGGAGGCTGCAGCCA No data
Right 907944090 1:59117112-59117134 TCACTGCCTTCAAGGGGCGGAGG No data
907944080_907944084 -10 Left 907944080 1:59117069-59117091 CCAATGGAAGGAGGCTGCAGCCA No data
Right 907944084 1:59117082-59117104 GCTGCAGCCAAGAGCGAAGGGGG No data
907944080_907944087 13 Left 907944080 1:59117069-59117091 CCAATGGAAGGAGGCTGCAGCCA No data
Right 907944087 1:59117105-59117127 CAGTGAGTCACTGCCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907944080 Original CRISPR TGGCTGCAGCCTCCTTCCAT TGG (reversed) Intergenic
No off target data available for this crispr