ID: 907944084

View in Genome Browser
Species Human (GRCh38)
Location 1:59117082-59117104
Sequence GCTGCAGCCAAGAGCGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907944078_907944084 -5 Left 907944078 1:59117064-59117086 CCAGCCCAATGGAAGGAGGCTGC No data
Right 907944084 1:59117082-59117104 GCTGCAGCCAAGAGCGAAGGGGG No data
907944080_907944084 -10 Left 907944080 1:59117069-59117091 CCAATGGAAGGAGGCTGCAGCCA No data
Right 907944084 1:59117082-59117104 GCTGCAGCCAAGAGCGAAGGGGG No data
907944079_907944084 -9 Left 907944079 1:59117068-59117090 CCCAATGGAAGGAGGCTGCAGCC No data
Right 907944084 1:59117082-59117104 GCTGCAGCCAAGAGCGAAGGGGG No data
907944077_907944084 -4 Left 907944077 1:59117063-59117085 CCCAGCCCAATGGAAGGAGGCTG No data
Right 907944084 1:59117082-59117104 GCTGCAGCCAAGAGCGAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907944084 Original CRISPR GCTGCAGCCAAGAGCGAAGG GGG Intergenic
No off target data available for this crispr