ID: 907944668

View in Genome Browser
Species Human (GRCh38)
Location 1:59124537-59124559
Sequence TGAATGTATGAATGACATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907944668_907944669 10 Left 907944668 1:59124537-59124559 CCATCATGTCATTCATACATTCA No data
Right 907944669 1:59124570-59124592 GTTGATTTTACTACCCTGCCTGG No data
907944668_907944670 11 Left 907944668 1:59124537-59124559 CCATCATGTCATTCATACATTCA No data
Right 907944670 1:59124571-59124593 TTGATTTTACTACCCTGCCTGGG No data
907944668_907944671 20 Left 907944668 1:59124537-59124559 CCATCATGTCATTCATACATTCA No data
Right 907944671 1:59124580-59124602 CTACCCTGCCTGGGTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907944668 Original CRISPR TGAATGTATGAATGACATGA TGG (reversed) Intergenic
No off target data available for this crispr