ID: 907944671

View in Genome Browser
Species Human (GRCh38)
Location 1:59124580-59124602
Sequence CTACCCTGCCTGGGTCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907944668_907944671 20 Left 907944668 1:59124537-59124559 CCATCATGTCATTCATACATTCA No data
Right 907944671 1:59124580-59124602 CTACCCTGCCTGGGTCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907944671 Original CRISPR CTACCCTGCCTGGGTCAAAC AGG Intergenic
No off target data available for this crispr