ID: 907946886

View in Genome Browser
Species Human (GRCh38)
Location 1:59143747-59143769
Sequence CAGGGTGATGAGAGATATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907946883_907946886 11 Left 907946883 1:59143713-59143735 CCGTTAAATGAATAATTAAACAA No data
Right 907946886 1:59143747-59143769 CAGGGTGATGAGAGATATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907946886 Original CRISPR CAGGGTGATGAGAGATATGA TGG Intergenic
No off target data available for this crispr