ID: 907947630

View in Genome Browser
Species Human (GRCh38)
Location 1:59150179-59150201
Sequence CCAGTTCCACTGGTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 279}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907947630_907947638 22 Left 907947630 1:59150179-59150201 CCTTCCACCACCAGTGGAACTGG 0: 1
1: 0
2: 0
3: 20
4: 279
Right 907947638 1:59150224-59150246 AGATGTAATGGAGAAAAGAGTGG 0: 1
1: 0
2: 5
3: 40
4: 540
907947630_907947637 10 Left 907947630 1:59150179-59150201 CCTTCCACCACCAGTGGAACTGG 0: 1
1: 0
2: 0
3: 20
4: 279
Right 907947637 1:59150212-59150234 AACAAAGATTGAAGATGTAATGG 0: 1
1: 0
2: 1
3: 44
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907947630 Original CRISPR CCAGTTCCACTGGTGGTGGA AGG (reversed) Intergenic
902850337 1:19150586-19150608 ACAGTTCCACTGGTCGTAGTGGG + Exonic
903068662 1:20715738-20715760 CCAGTGCCATTGTTGGTGGGGGG - Intronic
903969139 1:27107697-27107719 CCAGTTCCAGTGGTGGGAGCCGG + Exonic
904869916 1:33610419-33610441 CCACATCCACAGGTGATGGATGG + Intronic
905467016 1:38162726-38162748 CCTGCTCCACTGGGAGTGGAAGG - Intergenic
905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG + Intronic
905877249 1:41440258-41440280 ACAATGTCACTGGTGGTGGATGG + Intergenic
906053915 1:42899663-42899685 CCTGTTCCAGTGGAGGTGGCAGG + Intergenic
906165126 1:43680416-43680438 CAAGTTCCAAAGGAGGTGGAAGG - Intronic
906895441 1:49765126-49765148 CCTGTTCCATGGGGGGTGGAGGG - Intronic
907947630 1:59150179-59150201 CCAGTTCCACTGGTGGTGGAAGG - Intergenic
913143181 1:115962170-115962192 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
915095615 1:153460244-153460266 CCAGCTCCACAGAGGGTGGAGGG - Intronic
916179485 1:162070971-162070993 CCAGGTCCACCGTTGGGGGAGGG + Intronic
916763133 1:167834754-167834776 CCAGTCCCACTGGAGTTTGATGG + Intronic
918158411 1:181873020-181873042 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
918969545 1:191396856-191396878 CCAGTTCCACGTGTCTTGGAAGG - Intergenic
921215259 1:212931446-212931468 CCAGTTCCATGGCTGGTGCAGGG - Intergenic
921409747 1:214823248-214823270 CCTGTTCCAGTGGAGGTGGTGGG + Intergenic
921887292 1:220319808-220319830 CTGCTTCCACTCGTGGTGGATGG - Intergenic
921937010 1:220804742-220804764 CCACTTTGACTGGTGGTGGGGGG - Intronic
923035897 1:230285004-230285026 AAGCTTCCACTGGTGGTGGAAGG + Intergenic
924303658 1:242665248-242665270 CCAGTGCCACTGAAGGTGGCAGG + Intergenic
1065093480 10:22258902-22258924 TCAGATAAACTGGTGGTGGAAGG - Intergenic
1065571234 10:27072604-27072626 CCAGTTGCAGTGGTAGTGGTGGG - Intronic
1069413615 10:68178336-68178358 CAAGATCCACTGGTGATGAATGG - Intronic
1070519067 10:77236046-77236068 CCTGCTCCCCTGGAGGTGGATGG - Intronic
1070679381 10:78437997-78438019 GCACTTCCACTGGGGGTGGCAGG - Intergenic
1073382881 10:103094118-103094140 CAAGTAGCACTGGTGGTGGGGGG - Intronic
1075155508 10:119973376-119973398 CCAGTTTGATTGGTTGTGGAAGG + Intergenic
1076114631 10:127886736-127886758 CCAGTTCCACTTGAGGAGCAGGG - Intronic
1076344095 10:129768757-129768779 CCACTTCCCCTGCTGGAGGATGG + Intergenic
1077233249 11:1468113-1468135 CCAGCTCCACTGGGGCTGAAGGG - Intergenic
1079273661 11:19013274-19013296 CCTGTTCCAGTGGAGGTGGCAGG + Intergenic
1080456857 11:32426881-32426903 CCAGTCCCGCAGGTGGAGGAGGG - Intronic
1083292169 11:61696362-61696384 TCAGGTCCACTGGGAGTGGAAGG - Intronic
1085508549 11:77073799-77073821 CCAGCTCGCCTGGTGGTGGCTGG + Intronic
1085747874 11:79129991-79130013 CCTGTTCCAGTGGAGGTGGCAGG - Intronic
1086825380 11:91489588-91489610 CCTGTTCCAGTGGAGGTGGCAGG + Intergenic
1088239584 11:107759305-107759327 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
1088879413 11:113961892-113961914 AAACTTCCACTGATGGTGGAGGG + Intergenic
1088952436 11:114585187-114585209 CCAGTTCTGCAGGTGGAGGATGG + Intronic
1090974323 11:131668955-131668977 CTTGTTCCACTGGTGGTGGCCGG + Intronic
1091665986 12:2418850-2418872 CCAGCTCCACTGCTTGTAGAGGG + Intronic
1093124168 12:15307857-15307879 CCACTTCCAGGGGTGGAGGAGGG + Intronic
1093656943 12:21705821-21705843 CTGCTTCCACTCGTGGTGGAAGG - Intronic
1095225376 12:39672076-39672098 CAAGTGGCACTGGTGGTGGCAGG + Intronic
1097295542 12:57958490-57958512 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
1097519438 12:60648511-60648533 CCAGTTCCATAGCTGGTGGGGGG - Intergenic
1100571156 12:95844143-95844165 ACAGTTACACAGGTGGTAGATGG + Intergenic
1102280459 12:111614785-111614807 CTAGTTCAACTGGGGTTGGATGG + Intergenic
1103681341 12:122696485-122696507 CCAGATCCATCGCTGGTGGAGGG + Intergenic
1103683071 12:122709910-122709932 CCAGATCCATCGCTGGTGGAGGG + Intergenic
1106791656 13:33161796-33161818 CCAGTTCCACATGTGTGGGAAGG + Intronic
1107034198 13:35883451-35883473 CTACTTCCACTCATGGTGGAAGG - Intronic
1107164127 13:37265486-37265508 ACAGTTCCACAGGCTGTGGAGGG - Intergenic
1108020372 13:46121906-46121928 CCAGTTTGACAGGCGGTGGAGGG + Intergenic
1108132464 13:47317524-47317546 CCATTTCCTGTGATGGTGGATGG + Intergenic
1108188983 13:47917622-47917644 CCTGTTCCTCAGGTGGTGGGTGG - Intergenic
1108801466 13:54101343-54101365 ACTGTTCCAATGGTTGTGGAAGG - Intergenic
1108817151 13:54305659-54305681 CCTGTTCCAGTGGAGGTGGTGGG - Intergenic
1110881605 13:80578408-80578430 CCTGTTCCGGTGGAGGTGGAGGG - Intergenic
1111332877 13:86782766-86782788 CCAGTCTTATTGGTGGTGGAAGG + Intergenic
1112632653 13:101179612-101179634 TCAGTTCCCCTGATGGGGGATGG - Intronic
1113890634 13:113733359-113733381 CCACGTCCCCTGGTGCTGGAGGG + Intronic
1115765053 14:36614643-36614665 CTGCTTCCACTCGTGGTGGAAGG - Intergenic
1115835436 14:37397359-37397381 CCTGTTCCAGTGGAGGTGGTGGG + Intronic
1116335593 14:43652035-43652057 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
1116523781 14:45880275-45880297 CAAGCTCCACTGCTGGGGGATGG + Intergenic
1117894760 14:60472316-60472338 CCAGCTCCAATAGTAGTGGATGG + Intronic
1120093964 14:80366675-80366697 CCAGTTCCATTGTTGGAGAATGG - Intronic
1120210664 14:81630557-81630579 CCAGGACCCCTGGCGGTGGAAGG + Intergenic
1120527007 14:85588917-85588939 CCAGTTCCATTCATGTTGGATGG + Intronic
1120733711 14:88030357-88030379 CTACTTCCACTCATGGTGGAAGG - Intergenic
1124380773 15:29162915-29162937 CCTGTTCCAGTGGAGGTGGTGGG - Intronic
1124667958 15:31609826-31609848 CCTGTTCCAGTGGAGGTGGCAGG - Intronic
1125423845 15:39530574-39530596 CTGCTTCCACTTGTGGTGGAGGG + Intergenic
1127333453 15:57961090-57961112 CAAATTCCACTGGTGGTATAGGG - Intronic
1129097551 15:73225189-73225211 CCTGTTCCAGTGGAGGTGGCAGG + Intronic
1129191062 15:73937829-73937851 CCAGCACCACTGGTGGGGGTAGG - Intronic
1129477922 15:75798971-75798993 CCAGCTACACAGGAGGTGGACGG + Intergenic
1131800800 15:96067663-96067685 CCGCTTCCACTCATGGTGGAAGG - Intergenic
1132317478 15:100900561-100900583 CCAAGTCCACTGGAGGGGGAGGG - Exonic
1135382964 16:22008925-22008947 CAGCTTCCTCTGGTGGTGGAGGG - Intronic
1135678542 16:24437814-24437836 CTACTTCCACTCATGGTGGAAGG - Intergenic
1135806954 16:25551419-25551441 ACAGTGCTATTGGTGGTGGAGGG + Intergenic
1136127747 16:28196848-28196870 CTACTTCCACTCCTGGTGGACGG - Intronic
1136222414 16:28836755-28836777 TCAGTTCCCCGGGGGGTGGAAGG - Exonic
1137324514 16:47420721-47420743 CTGCTTCCACTTGTGGTGGAAGG - Intronic
1137541722 16:49367454-49367476 TCAGAGACACTGGTGGTGGAAGG - Intergenic
1137731909 16:50695826-50695848 ACAGTTTCACTGGAGCTGGATGG + Intronic
1140704596 16:77614982-77615004 CTACTTCCACTTATGGTGGAAGG + Intergenic
1142778131 17:2157922-2157944 CAGGTTCTACTGGTGGTGGGAGG - Intronic
1142849301 17:2696571-2696593 CCAGCTCCACCGGTGGCAGAGGG - Intronic
1144036964 17:11375906-11375928 TCAGTTCAGCAGGTGGTGGAAGG + Intronic
1144139623 17:12336269-12336291 CCTGTTCCAGTGGAGGTGGTGGG + Intergenic
1144403074 17:14925568-14925590 CTAGTTCCACTGGTCAGGGATGG + Intergenic
1144726462 17:17504922-17504944 CCAGTTCTGCTGCTGGTGGCAGG - Intergenic
1146568132 17:33930805-33930827 GCAGACCCACAGGTGGTGGAGGG + Intronic
1147606777 17:41778060-41778082 CAAGCCCCACTGGTGGTGGTTGG - Intronic
1150618754 17:66792801-66792823 CCATCTCCCCTGGTGGTGGCAGG + Intronic
1150624956 17:66835632-66835654 CCAGCTCAACAGGTGGTGGTGGG - Intronic
1151048463 17:70948531-70948553 CCTGTTCCAGTGGAGGTGGCCGG - Intergenic
1151141027 17:71992491-71992513 CTGCTTCCACTCGTGGTGGAAGG - Intergenic
1151564517 17:74890349-74890371 CCAGTTCCAAGTGTGGGGGAAGG - Intronic
1152424206 17:80210226-80210248 GCAGTGCCCCTGGTGGTGGAGGG + Exonic
1152632901 17:81418514-81418536 CCCGGCCCACTGGTGGTAGAGGG - Intronic
1152710763 17:81869651-81869673 CTACTTCCACTGGTGGGGGTGGG - Intronic
1152931839 17:83113951-83113973 GCAGGTCCGCTGGTGGTGGGGGG + Intergenic
1153268419 18:3295187-3295209 CCAGTTCCAACGTTTGTGGAAGG + Intergenic
1154172839 18:12063499-12063521 CCAGCCCCACTGGTCCTGGAGGG - Intergenic
1155904307 18:31430348-31430370 CCTGTTCCAGCGGTGGTGGGGGG + Intergenic
1156667542 18:39425850-39425872 CCTGTTCCAATGGAGGTGGTAGG - Intergenic
1157200036 18:45652320-45652342 CTAGTTCCACTTGGGGTAGAAGG - Intronic
1157540916 18:48505829-48505851 CCTGTTCCAGTGGAGGTGGTGGG - Intergenic
1158179143 18:54693511-54693533 CCACTTCTACTTGTGGTGGATGG - Intergenic
1159814508 18:73056086-73056108 CTGCTTCCACTGATGGTGGAGGG + Intergenic
1160304236 18:77717200-77717222 CCAGTGTCTCAGGTGGTGGAGGG + Intergenic
1160343838 18:78112922-78112944 CAAGTTCCACGGTTGGTCGAGGG + Intergenic
1161111970 19:2475720-2475742 CAAGTTCTGCTGGGGGTGGAGGG - Intergenic
1161948804 19:7455730-7455752 ACAGTTCCACCTGTGGGGGAAGG + Intronic
1162926054 19:13930949-13930971 CCGGTTCCCCTGGAAGTGGATGG + Intergenic
1163191617 19:15680880-15680902 CCAGTTCTTCTGGATGTGGAAGG + Intronic
1165310719 19:35028123-35028145 GCCCTTCCACTGGTGGGGGATGG - Intergenic
1166604203 19:44126425-44126447 CCTGTTCCAGTGGAGGTGGTGGG + Intronic
1167540557 19:50084606-50084628 CTACTTCCACTCTTGGTGGAAGG + Intergenic
1167571810 19:50293217-50293239 CCAGTTCCTGTGATGATGGAGGG - Exonic
926117220 2:10221175-10221197 CCAATTCCTCTGGGGGTGGGGGG + Intergenic
929446771 2:42008366-42008388 CAAGTTACACTGGAGGTTGAAGG + Intergenic
929968638 2:46554269-46554291 CCAGTTCACCTGGTGGAGAAGGG + Intronic
930713407 2:54570545-54570567 ACAGTTGCACTCTTGGTGGAGGG - Intronic
932715782 2:74100172-74100194 CCAGCCCCACTGGGGGTGGGAGG - Intronic
933121411 2:78542292-78542314 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
935888289 2:107648435-107648457 CAAGTGCCCCTGGTGGTTGAGGG - Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936674787 2:114702423-114702445 CCTGGTCCACTGGTAGTGGGTGG + Intronic
937379581 2:121364418-121364440 CCAGCTCCACAGGTGGGAGAAGG + Intronic
937521847 2:122721248-122721270 CCTGTTCCACTGGAGGTGCCAGG - Intergenic
937529332 2:122809116-122809138 CCTGTTCCAGTGGAGGTGGTGGG - Intergenic
938617507 2:133014354-133014376 ATAGCTTCACTGGTGGTGGATGG - Intronic
940709342 2:157143710-157143732 CCTGTTCCAGTGGAGGTGGCAGG + Intergenic
945442440 2:209896123-209896145 CCAGTTCAGCTGGTGGTGAAGGG + Intronic
945593739 2:211766968-211766990 CCAGTCAGACTGGTGTTGGAAGG - Intronic
946036511 2:216746553-216746575 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
947128570 2:226897577-226897599 CTACTTCCACTCATGGTGGAAGG + Intronic
948217052 2:236239729-236239751 CCAGCTCCCCTGGTGGGGAAGGG - Intronic
948939844 2:241190246-241190268 CCAGAGCCTCTGGGGGTGGATGG + Intronic
1171378593 20:24714547-24714569 CCTGTTCCAGTGGTGGTAGCAGG + Intergenic
1172015280 20:31869643-31869665 CCAGCTGCCCTGGGGGTGGAAGG - Intronic
1172494840 20:35373059-35373081 CCAGTTCCACAGGTTTTGGAAGG - Intronic
1173227080 20:41168321-41168343 CCAGGTCCCCTGGCTGTGGAGGG - Intronic
1174180612 20:48672098-48672120 CCACTTCCAGTGTTGGTGGCTGG - Intronic
1174530816 20:51212189-51212211 CGTTTTCCTCTGGTGGTGGAAGG + Intergenic
1175535444 20:59707809-59707831 GAAGTTCCACTCATGGTGGAAGG - Intronic
1175706614 20:61183351-61183373 CCAATTCCAGTGGTGTGGGAAGG - Intergenic
1175986165 20:62765111-62765133 CAGGCTCCACTGTTGGTGGAGGG - Intergenic
1178491304 21:33053887-33053909 CCAGTCACACTGCTGGTAGATGG - Intergenic
1178801733 21:35801672-35801694 CCTGTTCCAGTGGAGGTGGCAGG - Intronic
1178959091 21:37047618-37047640 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
1179173801 21:38992618-38992640 CAAGTTCCCCTGATGATGGAAGG - Intergenic
1179732240 21:43374376-43374398 TCAGCAACACTGGTGGTGGAGGG - Intergenic
1184060280 22:42077390-42077412 CCAGTGCCACTGGGGGTCGGTGG - Exonic
1184440131 22:44506145-44506167 CGGCTTCCACTTGTGGTGGAAGG - Intergenic
1184730385 22:46368348-46368370 CAAGGTCCACAGGTCGTGGATGG + Intronic
951179631 3:19644314-19644336 CCTGACCCACTGGTGGTGGATGG - Intergenic
951379889 3:21969785-21969807 ATAGTTCCAGTGGTGGTGGGTGG + Intronic
951840509 3:27028668-27028690 CAGGTTCCACTGGTGTTGGCAGG - Intergenic
954140634 3:48603367-48603389 CCAGTCCCAGTGGTGGCGGCAGG + Intronic
954843119 3:53530633-53530655 CCACTTCCATGGGTGGTGGGTGG + Intronic
955617842 3:60827765-60827787 CCAGCTCCACTGATAGTGAAAGG + Intronic
956950318 3:74274408-74274430 CCTGTTCCAGTGGAGGTGGCGGG - Intronic
957080383 3:75631661-75631683 CCAGCACCACTGATGGTAGAGGG + Intergenic
957262037 3:77914339-77914361 CCAATTCCACTGGATGTGGTGGG + Intergenic
957613012 3:82493002-82493024 CCTTTTCCACTGTGGGTGGATGG - Intergenic
959279821 3:104323734-104323756 CCTGTTTCAGTGGAGGTGGAGGG - Intergenic
959756923 3:109910571-109910593 CCTGTTCCAGTGGAGGTGAAAGG + Intergenic
961710391 3:128823871-128823893 CCAGAGCCATGGGTGGTGGAAGG - Intergenic
962065965 3:131981078-131981100 CCTGTTCCAGTGGAGGTGGTGGG + Intronic
962183397 3:133232414-133232436 CTGCTTCCACTGGTGGTGGAAGG - Intronic
964545937 3:157833652-157833674 CCAGTTCCACTGGTGAATTAGGG - Intergenic
965686623 3:171310252-171310274 CCAGTCCCACTGTTTGTGGAGGG - Intronic
966718910 3:183041578-183041600 CCAGTTTCAATCCTGGTGGAAGG + Exonic
968561227 4:1283814-1283836 GAAATTCCACTGTTGGTGGAGGG - Intergenic
968612630 4:1564065-1564087 CCAGTGCCAACGGTGGTGCAGGG - Intergenic
971746454 4:30587083-30587105 CGAGTTCCACTGGCGGTAGGAGG - Intergenic
973573740 4:52265441-52265463 CCAGCTCCGCTGCTGGTGAAAGG - Intergenic
976824981 4:89250151-89250173 CTGGTCCCACTGGTGGGGGAGGG + Exonic
976856535 4:89610531-89610553 CCTGTTCCATTGGAGGTGGTGGG - Intergenic
978448666 4:108805288-108805310 CTACTTCCACTGATGGTGAATGG - Intergenic
980063496 4:128156256-128156278 CCAGCTGGACTGGTGGGGGAAGG - Intronic
981580221 4:146243001-146243023 TGAGTTCCATTGGTGGTGGTGGG + Intergenic
983107216 4:163702272-163702294 TTAGCTCCACTGGTGATGGAGGG + Intronic
986151785 5:5136703-5136725 CCAGTTCCTCTAGCGGTGCACGG - Intergenic
987655991 5:20806850-20806872 AAACTTCCACTCGTGGTGGAAGG + Intergenic
988990087 5:36662182-36662204 CCAGGACCACTGATGGTGGCGGG - Intronic
994771832 5:103991164-103991186 CCAATTCCACTGTTGTTGCAAGG + Intergenic
994875361 5:105414252-105414274 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
995016324 5:107313783-107313805 CCAGTTCCAAAAGTGGAGGACGG + Intergenic
997677064 5:135720819-135720841 GGAGTTCTCCTGGTGGTGGACGG + Intergenic
997760976 5:136446829-136446851 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
1000779700 5:165465286-165465308 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
1001568955 5:172717813-172717835 CCAGGGCCACTGGTGGAAGAAGG + Intergenic
1003667118 6:8121716-8121738 GCTGTTCCACTGGTGGCAGAAGG - Intergenic
1003727821 6:8785873-8785895 CCAGTCCCCCTGGGGGAGGAGGG + Intergenic
1004819176 6:19348110-19348132 CCAGCAACACTGGGGGTGGAGGG - Intergenic
1007617119 6:43186704-43186726 CCTCTTCCACTGGTGTTGGTGGG - Intronic
1009058934 6:58374381-58374403 CTACTTCCACTCATGGTGGAAGG + Intergenic
1009231907 6:61072742-61072764 CTACTTCCACTCATGGTGGAAGG - Intergenic
1009583516 6:65566993-65567015 CCAGTTCAAGTGTTGGTAGATGG + Intronic
1010008904 6:71027923-71027945 CCTGTTCCATTGGAGGTGGTAGG + Intergenic
1011133088 6:84072460-84072482 CCTGTTCCAGTGGAGGTGGTAGG + Intronic
1011893250 6:92193794-92193816 CCTGTTCCAGTGGAGGTGGTGGG + Intergenic
1013839458 6:114372983-114373005 TCAATGCCACTAGTGGTGGAGGG + Intergenic
1014592763 6:123293596-123293618 CCTGTTCCAATGGGGGTGGCAGG - Intronic
1015197098 6:130536351-130536373 CCAATCCCAATGGTGGTAGAAGG + Intergenic
1015362310 6:132354539-132354561 CCTGTTCCAGTGGAGGTGGCAGG + Intronic
1015811159 6:137163517-137163539 CCATTTGCACTGTTGGAGGAAGG - Intronic
1017670153 6:156762878-156762900 CCAGTCCCAACGGAGGTGGAAGG + Intergenic
1017727391 6:157284992-157285014 CCAGGGCCACTGGTGGGTGAAGG - Intergenic
1018009462 6:159656044-159656066 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
1020634953 7:10685301-10685323 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
1021309335 7:19073770-19073792 CATATTCCAGTGGTGGTGGATGG - Intronic
1021352042 7:19605804-19605826 GCACTTTCACTGCTGGTGGATGG - Intergenic
1023360554 7:39410883-39410905 CCAGTCTCACAGCTGGTGGATGG - Intronic
1024917176 7:54514949-54514971 CCTGTTCCAGTGGAGGTGGCAGG + Intergenic
1026508720 7:71009517-71009539 TCAGTTTGACTGGTTGTGGAAGG + Intergenic
1027267900 7:76504143-76504165 CAAGGTCCACCTGTGGTGGATGG + Intronic
1027319711 7:77004005-77004027 CAAGGTCCACCTGTGGTGGATGG + Intergenic
1030160700 7:106505615-106505637 CCAGCTCCACTGGGGGTGAGAGG - Intergenic
1030192257 7:106821556-106821578 GCAGATCCAATGGTGCTGGAGGG + Intergenic
1030808449 7:113945564-113945586 CCAGCTGCACTGGTAGTGGTAGG - Intronic
1030909548 7:115229681-115229703 CCACTTGCACTTGTGGTTGATGG - Intergenic
1033163252 7:139015889-139015911 CCATTCCCACAGGAGGTGGATGG + Intergenic
1034319639 7:150168420-150168442 ACAGTTCCACTGGGGGGTGATGG - Intergenic
1035041933 7:155935450-155935472 CCAGTTCCACAGCTTCTGGATGG - Intergenic
1035290934 7:157838001-157838023 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035290944 7:157838057-157838079 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035290953 7:157838113-157838135 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035290962 7:157838169-157838191 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035290971 7:157838225-157838247 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035290981 7:157838281-157838303 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035290991 7:157838337-157838359 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035290999 7:157838393-157838415 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035291009 7:157838449-157838471 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035291019 7:157838505-157838527 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035291029 7:157838561-157838583 CCAGTTCCTCTCATAGTGGATGG + Intronic
1035291039 7:157838617-157838639 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291049 7:157838673-157838695 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291059 7:157838729-157838751 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291069 7:157838785-157838807 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291079 7:157838841-157838863 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291089 7:157838897-157838919 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291098 7:157838953-157838975 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035291108 7:157839009-157839031 CCAGTTCCTCTCGTAGTGGATGG + Intronic
1035691824 8:1564323-1564345 CCAGTTTCACAGATGGTGGATGG + Intronic
1036910632 8:12754899-12754921 CCAGTGCCACTGATGCTGAAGGG - Exonic
1037977325 8:23222934-23222956 AAACTTCCACTGGTGGTGAAGGG - Intronic
1038599681 8:28927461-28927483 CTACTTCCACTCATGGTGGAAGG + Intronic
1038781901 8:30575358-30575380 CCAACTCCACTGGTTGGGGATGG - Intergenic
1039123634 8:34175942-34175964 CCTGTTCCAGTGGAGGTGGTGGG - Intergenic
1040559803 8:48514436-48514458 CCAGTTCTCCTGGTCCTGGAGGG - Intergenic
1041537438 8:58942923-58942945 AAACTTCTACTGGTGGTGGAAGG - Intronic
1041552928 8:59120079-59120101 CCAGCTCGCCTGGGGGTGGACGG + Intergenic
1043040841 8:75259935-75259957 CCTGTTCCAGTGGAGGTGGCAGG - Intergenic
1044130007 8:88509946-88509968 CTACTTCCACTCATGGTGGAAGG - Intergenic
1044803527 8:95981400-95981422 CCAGTTCCTCTGGTGGGAGGTGG - Intergenic
1045000669 8:97875346-97875368 TCAGTCCCTCTGTTGGTGGAAGG + Intronic
1046839723 8:118842840-118842862 CTATTTCCACTCATGGTGGAAGG - Intergenic
1048355211 8:133648058-133648080 CTGCTTCCACTGATGGTGGAAGG - Intergenic
1049604255 8:143521710-143521732 GCAGGTGCACTGGTGGGGGAGGG - Intronic
1052159608 9:25240712-25240734 CCATTTCCACTGGTGCTACAGGG - Intergenic
1052193723 9:25686817-25686839 CTGCTTCCACTCGTGGTGGAAGG - Intergenic
1052488500 9:29132463-29132485 CCAGTCTCATTGGTTGTGGAAGG - Intergenic
1053741121 9:41139362-41139384 CCTGTTCCAGTGGAGGTGGTAGG + Intronic
1054346331 9:63968851-63968873 CCTGTTCCAGTGGAGGTGGTAGG + Intergenic
1054444107 9:65295501-65295523 CCTGTTCCAGTGGAGGTGGTAGG + Intergenic
1054486164 9:65726004-65726026 CCTGTTCCAGTGGAGGTGGTAGG - Intronic
1054687228 9:68291935-68291957 CCTGTTCCAGTGGAGGTGGTAGG - Intronic
1056938556 9:90936530-90936552 CCACTTCCCCTGGGGGTGGGTGG - Intergenic
1058678251 9:107419830-107419852 CAAGTTCTGCTGGTGGGGGAAGG - Intergenic
1059650336 9:116310261-116310283 CCTTTGCCAATGGTGGTGGAAGG + Intronic
1059652172 9:116325084-116325106 CCACTTCCTCTGGTGGAGAAAGG - Intronic
1187529985 X:20087441-20087463 CTACTTCCACTCATGGTGGAAGG - Intronic
1188522464 X:31054011-31054033 CCAGTTCGGCTGAGGGTGGAAGG - Intergenic
1189385192 X:40531387-40531409 ACAGTTCCACTGCGGGTGTAAGG - Intergenic
1189917500 X:45870763-45870785 CCAGGCCCATTGGTGGTGCATGG - Intergenic
1190524164 X:51311386-51311408 CTAGTTTCTCTGGTGGTTGAAGG + Intergenic
1190735042 X:53250564-53250586 CCAGTGCCACTGTTGGGGGCTGG + Exonic
1191919464 X:66239162-66239184 CCAGTATCCCTGGTGGTTGAAGG + Intronic
1192881048 X:75284682-75284704 CCTGTTCCAGTGGAGGTGGCAGG + Intronic
1192900101 X:75487285-75487307 CCTGCTCCACTGGAGGTGGCAGG - Intronic
1192968129 X:76202064-76202086 CCTGTTCCAGTGGAGGTGGCAGG + Intergenic
1193473549 X:81935380-81935402 CTGCTTCCACTGGTGGTGAAGGG - Intergenic
1193779602 X:85685949-85685971 CCTGTTCCAGTGGAGGTGGTTGG + Intergenic
1194882516 X:99271736-99271758 CCTGTTCCAGTGGAGGTGGCAGG + Intergenic
1195366321 X:104130128-104130150 TCAGTTGGATTGGTGGTGGATGG - Intronic
1197669027 X:129255613-129255635 CCTGTTCCAGTGGAGGTGGCAGG + Intergenic
1198070472 X:133143350-133143372 CTACTTCCACTTATGGTGGAAGG - Intergenic
1198339325 X:135698878-135698900 GCAGTTTCACTGGTCCTGGATGG - Intergenic
1200746966 Y:6911343-6911365 CCAGCGCCACTGCTGGTGGGCGG + Intronic