ID: 907948924

View in Genome Browser
Species Human (GRCh38)
Location 1:59162048-59162070
Sequence AGGTTTTAACATATGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907948915_907948924 8 Left 907948915 1:59162017-59162039 CCTACCTCTTACTGCCATCACCA No data
Right 907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG No data
907948921_907948924 -6 Left 907948921 1:59162031-59162053 CCATCACCATAGGGGTTAGGTTT No data
Right 907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG No data
907948914_907948924 9 Left 907948914 1:59162016-59162038 CCCTACCTCTTACTGCCATCACC No data
Right 907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG No data
907948916_907948924 4 Left 907948916 1:59162021-59162043 CCTCTTACTGCCATCACCATAGG No data
Right 907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG No data
907948913_907948924 22 Left 907948913 1:59162003-59162025 CCTAATTAAGAGGCCCTACCTCT No data
Right 907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG No data
907948912_907948924 30 Left 907948912 1:59161995-59162017 CCTCATGACCTAATTAAGAGGCC No data
Right 907948924 1:59162048-59162070 AGGTTTTAACATATGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907948924 Original CRISPR AGGTTTTAACATATGGATTT TGG Intergenic
No off target data available for this crispr