ID: 907951020

View in Genome Browser
Species Human (GRCh38)
Location 1:59184306-59184328
Sequence CTGCAAGGAAAGATGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907951020_907951026 -4 Left 907951020 1:59184306-59184328 CCATTTTTCATCTTTCCTTGCAG No data
Right 907951026 1:59184325-59184347 GCAGTGTGGGGATGTGAGGTAGG No data
907951020_907951027 -3 Left 907951020 1:59184306-59184328 CCATTTTTCATCTTTCCTTGCAG No data
Right 907951027 1:59184326-59184348 CAGTGTGGGGATGTGAGGTAGGG No data
907951020_907951028 21 Left 907951020 1:59184306-59184328 CCATTTTTCATCTTTCCTTGCAG No data
Right 907951028 1:59184350-59184372 AAGTGATGCCTGAAACCTCCAGG No data
907951020_907951025 -8 Left 907951020 1:59184306-59184328 CCATTTTTCATCTTTCCTTGCAG No data
Right 907951025 1:59184321-59184343 CCTTGCAGTGTGGGGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907951020 Original CRISPR CTGCAAGGAAAGATGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr