ID: 907952439

View in Genome Browser
Species Human (GRCh38)
Location 1:59196676-59196698
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907952439_907952447 19 Left 907952439 1:59196676-59196698 CCCAGCTTGTGCTCACATCCCCA No data
Right 907952447 1:59196718-59196740 CTCATAAGGTAAGACAGTTCTGG No data
907952439_907952444 5 Left 907952439 1:59196676-59196698 CCCAGCTTGTGCTCACATCCCCA No data
Right 907952444 1:59196704-59196726 AGAGACCTTACTACCTCATAAGG No data
907952439_907952448 20 Left 907952439 1:59196676-59196698 CCCAGCTTGTGCTCACATCCCCA No data
Right 907952448 1:59196719-59196741 TCATAAGGTAAGACAGTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907952439 Original CRISPR TGGGGATGTGAGCACAAGCT GGG (reversed) Intergenic