ID: 907955960

View in Genome Browser
Species Human (GRCh38)
Location 1:59228571-59228593
Sequence GATGCTATATCAAGGCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907955949_907955960 24 Left 907955949 1:59228524-59228546 CCCCTTCAAACTTAGCACCAAGT No data
Right 907955960 1:59228571-59228593 GATGCTATATCAAGGCATCAGGG No data
907955951_907955960 22 Left 907955951 1:59228526-59228548 CCTTCAAACTTAGCACCAAGTGG No data
Right 907955960 1:59228571-59228593 GATGCTATATCAAGGCATCAGGG No data
907955956_907955960 7 Left 907955956 1:59228541-59228563 CCAAGTGGCTGGGTGGTCTTTTC No data
Right 907955960 1:59228571-59228593 GATGCTATATCAAGGCATCAGGG No data
907955950_907955960 23 Left 907955950 1:59228525-59228547 CCCTTCAAACTTAGCACCAAGTG No data
Right 907955960 1:59228571-59228593 GATGCTATATCAAGGCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907955960 Original CRISPR GATGCTATATCAAGGCATCA GGG Intergenic
No off target data available for this crispr