ID: 907957523

View in Genome Browser
Species Human (GRCh38)
Location 1:59244358-59244380
Sequence ACCAGGGATGTCCATACATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907957523_907957528 14 Left 907957523 1:59244358-59244380 CCCTATGTATGGACATCCCTGGT No data
Right 907957528 1:59244395-59244417 CCAATTTCCCTTTTCTTAAAAGG No data
907957523_907957531 21 Left 907957523 1:59244358-59244380 CCCTATGTATGGACATCCCTGGT No data
Right 907957531 1:59244402-59244424 CCCTTTTCTTAAAAGGGCACTGG No data
907957523_907957529 15 Left 907957523 1:59244358-59244380 CCCTATGTATGGACATCCCTGGT No data
Right 907957529 1:59244396-59244418 CAATTTCCCTTTTCTTAAAAGGG No data
907957523_907957533 30 Left 907957523 1:59244358-59244380 CCCTATGTATGGACATCCCTGGT No data
Right 907957533 1:59244411-59244433 TAAAAGGGCACTGGTCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907957523 Original CRISPR ACCAGGGATGTCCATACATA GGG (reversed) Intergenic
No off target data available for this crispr