ID: 907957528

View in Genome Browser
Species Human (GRCh38)
Location 1:59244395-59244417
Sequence CCAATTTCCCTTTTCTTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907957524_907957528 13 Left 907957524 1:59244359-59244381 CCTATGTATGGACATCCCTGGTG No data
Right 907957528 1:59244395-59244417 CCAATTTCCCTTTTCTTAAAAGG No data
907957520_907957528 30 Left 907957520 1:59244342-59244364 CCTCATATAGTCTTTTCCCTATG No data
Right 907957528 1:59244395-59244417 CCAATTTCCCTTTTCTTAAAAGG No data
907957523_907957528 14 Left 907957523 1:59244358-59244380 CCCTATGTATGGACATCCCTGGT No data
Right 907957528 1:59244395-59244417 CCAATTTCCCTTTTCTTAAAAGG No data
907957526_907957528 -3 Left 907957526 1:59244375-59244397 CCTGGTGTCTCTTTATGTGTCCA No data
Right 907957528 1:59244395-59244417 CCAATTTCCCTTTTCTTAAAAGG No data
907957525_907957528 -2 Left 907957525 1:59244374-59244396 CCCTGGTGTCTCTTTATGTGTCC No data
Right 907957528 1:59244395-59244417 CCAATTTCCCTTTTCTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907957528 Original CRISPR CCAATTTCCCTTTTCTTAAA AGG Intergenic
No off target data available for this crispr