ID: 907960349

View in Genome Browser
Species Human (GRCh38)
Location 1:59274069-59274091
Sequence AAGTGAGAACATGAGGCATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28445
Summary {0: 11, 1: 249, 2: 2263, 3: 6666, 4: 19256}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907960349_907960355 10 Left 907960349 1:59274069-59274091 CCAAATGCCTCATGTTCTCACTT 0: 11
1: 249
2: 2263
3: 6666
4: 19256
Right 907960355 1:59274102-59274124 GCTAAGCTATGGGCACGTAAAGG No data
907960349_907960356 30 Left 907960349 1:59274069-59274091 CCAAATGCCTCATGTTCTCACTT 0: 11
1: 249
2: 2263
3: 6666
4: 19256
Right 907960356 1:59274122-59274144 AGGCAGACAGAGTGATACAATGG No data
907960349_907960354 0 Left 907960349 1:59274069-59274091 CCAAATGCCTCATGTTCTCACTT 0: 11
1: 249
2: 2263
3: 6666
4: 19256
Right 907960354 1:59274092-59274114 ATATGTGGGAGCTAAGCTATGGG No data
907960349_907960353 -1 Left 907960349 1:59274069-59274091 CCAAATGCCTCATGTTCTCACTT 0: 11
1: 249
2: 2263
3: 6666
4: 19256
Right 907960353 1:59274091-59274113 TATATGTGGGAGCTAAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907960349 Original CRISPR AAGTGAGAACATGAGGCATT TGG (reversed) Intergenic
Too many off-targets to display for this crispr