ID: 907960350

View in Genome Browser
Species Human (GRCh38)
Location 1:59274076-59274098
Sequence CACATATAAGTGAGAACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43431
Summary {0: 77, 1: 2723, 2: 16315, 3: 17755, 4: 6561}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907960350_907960356 23 Left 907960350 1:59274076-59274098 CCTCATGTTCTCACTTATATGTG 0: 77
1: 2723
2: 16315
3: 17755
4: 6561
Right 907960356 1:59274122-59274144 AGGCAGACAGAGTGATACAATGG No data
907960350_907960354 -7 Left 907960350 1:59274076-59274098 CCTCATGTTCTCACTTATATGTG 0: 77
1: 2723
2: 16315
3: 17755
4: 6561
Right 907960354 1:59274092-59274114 ATATGTGGGAGCTAAGCTATGGG No data
907960350_907960355 3 Left 907960350 1:59274076-59274098 CCTCATGTTCTCACTTATATGTG 0: 77
1: 2723
2: 16315
3: 17755
4: 6561
Right 907960355 1:59274102-59274124 GCTAAGCTATGGGCACGTAAAGG No data
907960350_907960353 -8 Left 907960350 1:59274076-59274098 CCTCATGTTCTCACTTATATGTG 0: 77
1: 2723
2: 16315
3: 17755
4: 6561
Right 907960353 1:59274091-59274113 TATATGTGGGAGCTAAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907960350 Original CRISPR CACATATAAGTGAGAACATG AGG (reversed) Intergenic
Too many off-targets to display for this crispr