ID: 907960355

View in Genome Browser
Species Human (GRCh38)
Location 1:59274102-59274124
Sequence GCTAAGCTATGGGCACGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907960349_907960355 10 Left 907960349 1:59274069-59274091 CCAAATGCCTCATGTTCTCACTT 0: 11
1: 249
2: 2263
3: 6666
4: 19256
Right 907960355 1:59274102-59274124 GCTAAGCTATGGGCACGTAAAGG No data
907960350_907960355 3 Left 907960350 1:59274076-59274098 CCTCATGTTCTCACTTATATGTG 0: 77
1: 2723
2: 16315
3: 17755
4: 6561
Right 907960355 1:59274102-59274124 GCTAAGCTATGGGCACGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907960355 Original CRISPR GCTAAGCTATGGGCACGTAA AGG Intergenic
No off target data available for this crispr