ID: 907962425

View in Genome Browser
Species Human (GRCh38)
Location 1:59296404-59296426
Sequence TCTGACACACACACCCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907962421_907962425 7 Left 907962421 1:59296374-59296396 CCTACAACAGTCCTGGTGTTTAG 0: 1
1: 0
2: 0
3: 11
4: 120
Right 907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG 0: 1
1: 0
2: 4
3: 28
4: 282
907962423_907962425 -4 Left 907962423 1:59296385-59296407 CCTGGTGTTTAGTAAACGGTCTG 0: 1
1: 0
2: 0
3: 5
4: 57
Right 907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG 0: 1
1: 0
2: 4
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907962425 Original CRISPR TCTGACACACACACCCATCA GGG Intergenic
900230591 1:1555041-1555063 CCTGACAGACACACCCACGAGGG + Intronic
900876990 1:5349922-5349944 CCTGACACTCATCCCCATCATGG + Intergenic
901634045 1:10661578-10661600 TCAAACACACACACCCAACACGG + Intronic
902269092 1:15290219-15290241 TGGGACACACACAACCTTCAGGG + Intronic
903972744 1:27129699-27129721 GCTGGCACACACACCCAGGATGG + Intronic
904577964 1:31517595-31517617 TCTGTAACACACACCCATTGGGG - Intergenic
904998435 1:34649543-34649565 TCTCACACACACACAGAACAGGG + Intergenic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
906119524 1:43379606-43379628 TCTGGCACACCCACCCTACATGG + Intergenic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
908569505 1:65393890-65393912 TCTGAGACCCACACTCATGAAGG - Intronic
909666182 1:78135413-78135435 TCTCTCACACACACACATCAAGG - Intronic
910015906 1:82522922-82522944 AATGACACACACAACCATCAAGG - Intergenic
910437328 1:87218558-87218580 ACACACACACACACCCCTCAGGG + Intergenic
910814592 1:91277498-91277520 ACACACACACACACCCACCAGGG - Intronic
910933366 1:92464783-92464805 TCGCACACACACACCCAGGAAGG + Intergenic
914812438 1:151038749-151038771 TCCAACACACACACCCATCTTGG + Intronic
915048703 1:153043271-153043293 ACACACACACACACCCCTCATGG + Intergenic
915143183 1:153779322-153779344 TCTGTCTCCCACACCCACCAGGG + Exonic
915604767 1:156943646-156943668 TCAGACACTCTCACCCATCCTGG + Intronic
916185151 1:162124486-162124508 TCACACACACACACACACCATGG - Intronic
917061130 1:171041342-171041364 ACACACACACACACACATCATGG - Intronic
917626743 1:176854089-176854111 TCTGACACTCACATTCTTCAGGG - Intergenic
918132643 1:181643261-181643283 TCTGACACAGAAGCCCAACAGGG - Intronic
918960029 1:191262698-191262720 ACATACACACACACCCACCATGG + Intergenic
920969228 1:210728645-210728667 GCTTACACACACAGCCATCCAGG + Intronic
923435337 1:233963005-233963027 TCTGGGACACATCCCCATCATGG - Intronic
923658001 1:235935060-235935082 ACACACACAGACACCCATCAGGG - Intergenic
1065766086 10:29031002-29031024 TCAGACACACACACACACCCAGG + Intergenic
1065872648 10:29968959-29968981 ACTGACACACACACAGATCCAGG - Intergenic
1069241030 10:66139347-66139369 GCTGAAACACAAAGCCATCAAGG - Intronic
1070162909 10:73876422-73876444 TCTGCCCCACCCACCCCTCAGGG - Intergenic
1070957322 10:80473072-80473094 TCTGACCCAGAAACCCAACATGG - Intronic
1071058694 10:81543445-81543467 TCATACACACACACACATCATGG + Intergenic
1075582521 10:123633036-123633058 GCTGATACACTCTCCCATCAAGG - Intergenic
1076384550 10:130046916-130046938 GCTTACACACACACGCCTCAGGG - Intergenic
1077429288 11:2508057-2508079 TCAGACACAAACACCCAGCTCGG + Intronic
1078274469 11:9829976-9829998 TCTGCCACACAGGCCCACCAGGG + Intronic
1078699194 11:13664989-13665011 TCTTATATACACACCCATCATGG - Intergenic
1078777681 11:14408817-14408839 TCTGACCCACACAGTCATTAAGG - Intergenic
1079089667 11:17471741-17471763 GCTGACACACACACACAGGATGG + Intronic
1079335466 11:19566840-19566862 TCTGAAAGACACACCCACAAAGG + Intronic
1079671910 11:23181317-23181339 TCTCACACACACACACACCCAGG - Intergenic
1079937055 11:26630009-26630031 TCTGACACTAAAACCCTTCAAGG - Intronic
1080600012 11:33812836-33812858 TCTCACACACAAATACATCATGG + Intergenic
1080701657 11:34649472-34649494 TGTGAAACACACACCCATCAAGG - Intronic
1083269523 11:61564789-61564811 TCTGACACACACACCTTTTCTGG + Intronic
1083336511 11:61924805-61924827 TCAGACTCCCACACCCATCTGGG - Intergenic
1084214761 11:67641225-67641247 TCGCACACACACACGTATCAGGG - Intergenic
1085253490 11:75159233-75159255 TCAGACACACAGACCCATTGCGG + Intronic
1085504130 11:77046345-77046367 TTTGACACTCAAACCCCTCAAGG + Intergenic
1087681884 11:101227974-101227996 ACACACACACACACCCAACAGGG + Intergenic
1087846331 11:102977681-102977703 ACACACACACACACACATCAGGG - Intergenic
1088596405 11:111444174-111444196 ACACACACACACACCCCTCAGGG - Intronic
1089354013 11:117838051-117838073 ACACACACACACACACATCACGG + Exonic
1089940292 11:122409531-122409553 TTTCACCCACACCCCCATCAAGG - Intergenic
1090239171 11:125170050-125170072 TGTCACACACACACCAGTCAGGG - Intronic
1092688982 12:11086110-11086132 CCCCACACACACACCCCTCATGG + Intronic
1093418402 12:18947051-18947073 CCTGCCACCCACACCCATCATGG + Intergenic
1093625024 12:21335723-21335745 TCCCAAACACACACACATCAAGG + Intronic
1096116354 12:49057763-49057785 ACTGACACACATACACACCAAGG + Intronic
1097370388 12:58771774-58771796 ACAGACACACACACACACCATGG + Intronic
1098142400 12:67463618-67463640 TCTCACACACACACACACAAAGG - Intergenic
1099256163 12:80315584-80315606 TCTAACTGACACATCCATCATGG - Intronic
1099517930 12:83622114-83622136 TTTTACACACACACACATGAAGG - Intergenic
1099839917 12:87952567-87952589 TCTCACACACACACACATGCAGG + Intergenic
1102811458 12:115827696-115827718 TGTGTCACACACCACCATCACGG + Intergenic
1104947674 12:132423839-132423861 TCTGAGTCACGCACACATCAGGG - Intergenic
1107118823 13:36776522-36776544 TCTCACACAAACAACCATCCTGG - Intergenic
1112946381 13:104931852-104931874 CCTGACACACACACACATTATGG + Intergenic
1113559774 13:111269471-111269493 CCTGACAAACACACTCATTAAGG - Intronic
1113607513 13:111620875-111620897 TCAGACACACACACACATCCTGG - Intronic
1114334322 14:21672184-21672206 CCTGACACACACAGCCTTCCAGG + Intergenic
1114548771 14:23521686-23521708 ACAGACACATACACCCATCTTGG - Exonic
1114645256 14:24252476-24252498 TCTTACCCACACCCCCACCATGG - Intronic
1115156890 14:30351361-30351383 TCTTACACACACAGCTATAATGG + Intergenic
1115869855 14:37787870-37787892 ACAGACACACACACACATAAAGG - Intronic
1116354302 14:43908638-43908660 TCTGGCACAAACAACCATCTGGG + Intergenic
1118366696 14:65102475-65102497 ACTCACACACACACACAACACGG + Intronic
1118615571 14:67572440-67572462 TCAGACACACAGACCCCACAAGG + Intronic
1119266045 14:73263836-73263858 GCTGTCACACACACCTGTCAGGG - Intronic
1119366938 14:74100986-74101008 TCTTAAACACACACAAATCAGGG - Intronic
1119884722 14:78130595-78130617 TCACACACACACACAAATCAAGG - Intergenic
1120453062 14:84695621-84695643 TCTGCTGCACATACCCATCAGGG - Intergenic
1120656963 14:87201927-87201949 TCTGAGACACAGAACCAACATGG + Intergenic
1123065427 14:105616688-105616710 TCTAACACCCACACTCAGCAAGG - Intergenic
1125132279 15:36297299-36297321 TCTGAGAAATACATCCATCATGG + Intergenic
1125839828 15:42789774-42789796 ACTTACACACACACACATAATGG - Intronic
1126389111 15:48126683-48126705 TCTCTCATACACACCCCTCAGGG - Intronic
1127416436 15:58762145-58762167 ACACACACACACACCCCTCAAGG + Intergenic
1130366963 15:83249414-83249436 TTTGTCACCCACTCCCATCAGGG + Intergenic
1132930107 16:2454672-2454694 GCTGACACCCACACCCAACTGGG - Intronic
1133496979 16:6328074-6328096 TGTGACACAAACACACATAATGG + Intronic
1133757765 16:8775572-8775594 ACACACACACACAGCCATCAGGG + Intronic
1135991013 16:27218845-27218867 TCAAACACACACACACATAATGG + Intronic
1138445031 16:57058322-57058344 TCTGTCCCTCACACCCACCATGG + Intronic
1140598185 16:76440964-76440986 ACATACACACACACCCCTCATGG - Intronic
1140697344 16:77548277-77548299 TCTCACACACACCCCCGGCAGGG - Intergenic
1140928494 16:79605671-79605693 CCTGACAAAGACACCCAACACGG + Intergenic
1141441647 16:84033270-84033292 CCTGACACAAACACTCAGCAAGG + Intronic
1141459657 16:84170380-84170402 ACAGACACACACACCTCTCAGGG + Intronic
1142442958 16:90112778-90112800 CCTGATACAGACAGCCATCAAGG - Intergenic
1142984641 17:3688522-3688544 TCTGACACCCACCCCCAGGAAGG + Intronic
1145984789 17:29038214-29038236 GCTGACACACACAAGCAGCAAGG + Intronic
1146647961 17:34587803-34587825 TGTGACAAACAAAGCCATCATGG - Intronic
1146939724 17:36836127-36836149 CCTCACACACACACTCCTCAGGG - Intergenic
1147755529 17:42764758-42764780 TCTGAGACACACATCTCTCAGGG + Intergenic
1148350380 17:46937520-46937542 TGTAACTCACACTCCCATCAAGG + Intronic
1149634802 17:58157826-58157848 TTTGAAACAAACATCCATCATGG - Intergenic
1152060561 17:78071235-78071257 TCTGACACACATAACAAACATGG - Intronic
1155517793 18:26640518-26640540 GCTCACACACAGACTCATCAAGG - Intronic
1155611016 18:27667687-27667709 TCACACACACACACACATCCAGG + Intergenic
1156138467 18:34075344-34075366 TCTCTCACACACACCCACAAAGG - Intronic
1156722511 18:40087449-40087471 ACACACACACACACACATCAGGG - Intergenic
1158613077 18:58961093-58961115 TCTGACGCACACTCCAATCTTGG - Intronic
1159148233 18:64482644-64482666 ACACACACACACACACATCATGG - Intergenic
1161698361 19:5782621-5782643 TTGGAGACACACAGCCATCAGGG - Intergenic
1161911510 19:7198026-7198048 ACACACACACACGCCCATCATGG - Intronic
1164467516 19:28500502-28500524 GCTGACACACCCATCCATCCTGG - Intergenic
1165227211 19:34363506-34363528 TCTGAGAAACACTCCAATCAGGG - Intronic
1166084970 19:40468380-40468402 TCTGTCACACACACACAAAAGGG - Intronic
1166229862 19:41420346-41420368 TCTCACACACACACAAAACACGG - Intronic
1166277003 19:41761111-41761133 TGTGACACACACACCTGCCAGGG + Intronic
1166277420 19:41763653-41763675 TCTGACACACACACCTGCCCTGG + Intronic
1166415157 19:42589851-42589873 TGTGACACACACACCCACCGTGG - Intronic
1166419704 19:42626842-42626864 TCTGACATACACACCTGCCATGG - Intronic
1166424184 19:42661511-42661533 TGTGACACACACACCTGCCATGG + Intronic
1168216971 19:54933540-54933562 ACACACACACACACCCAGCAGGG + Intronic
925124879 2:1446977-1446999 ACACACACACACACCCCTCATGG - Intronic
925701718 2:6645632-6645654 TCAGATCCACACACCCATCCTGG - Intergenic
926823063 2:16874748-16874770 ACACACACACACACACATCATGG + Intergenic
928050187 2:27985052-27985074 ACACACACACACACACATCATGG - Intronic
929240485 2:39648485-39648507 TCTTACACACACACCCACCTGGG + Intergenic
929715472 2:44305220-44305242 TCTCACTTCCACACCCATCAGGG + Intronic
930424039 2:51190930-51190952 CCAGACACATACACCCACCAAGG - Intergenic
931037472 2:58259440-58259462 GCTGACATACACACCAAACAGGG - Intergenic
931533789 2:63249093-63249115 TCACACACACACACCCCACAAGG - Intronic
932069527 2:68604817-68604839 TCTGACATACCCACCAATAAAGG - Intronic
933177527 2:79192169-79192191 ACTGATTCCCACACCCATCATGG + Intronic
933309254 2:80639508-80639530 ACACACACACACACACATCAAGG - Intronic
933330194 2:80883670-80883692 TCTTTCACACACACCAAACATGG + Intergenic
933442450 2:82330396-82330418 ACACACACACACACACATCATGG - Intergenic
933489289 2:82965088-82965110 ACACACACACACACACATCATGG + Intergenic
933518113 2:83331761-83331783 ACACACACACACACACATCAGGG - Intergenic
935027969 2:99295614-99295636 TCAGCCACACTCACCCATCAGGG + Exonic
936125209 2:109783526-109783548 TCTGACACACAGAACCATTGGGG - Intergenic
936219484 2:110587942-110587964 TCTGACACACAGAACCATTGGGG + Intergenic
937990518 2:127659558-127659580 TCTGAAACACACACCCAAGGTGG + Intronic
939307581 2:140429450-140429472 ACTGACCCTGACACCCATCAGGG + Intronic
940549522 2:155135411-155135433 ACACACACACACACCTATCAGGG + Intergenic
941819836 2:169833110-169833132 TCTGACACTCACATACATGAAGG - Intronic
945867146 2:215189066-215189088 TCTCACACACACACACACAAAGG + Intergenic
945911067 2:215649841-215649863 ACACACACACACACACATCATGG - Intergenic
945951459 2:216042693-216042715 TGAGACACACACACACATAAAGG + Intronic
947231781 2:227894581-227894603 TGTGACAGACACACACAGCATGG + Intronic
1169091680 20:2864794-2864816 TCTGACACTAACCCCCATCCTGG - Intronic
1169209023 20:3755423-3755445 TCTCACTCCCACACCCATCCAGG + Intronic
1169226933 20:3862808-3862830 TCCAGCACACAAACCCATCATGG + Intronic
1169506810 20:6220262-6220284 ACTGACAGACACACACACCAAGG + Intergenic
1170895430 20:20408723-20408745 TCTCACACACACACACATATTGG - Intronic
1170964618 20:21055319-21055341 TCTGACACACAGACCCAGGAAGG - Intergenic
1172012620 20:31854739-31854761 TCAGACACACACACCCAGCAAGG - Intronic
1172245145 20:33440812-33440834 TCTCACACACACACACAAAAAGG + Intronic
1172272259 20:33661297-33661319 ACACACACACACACGCATCAGGG + Intronic
1174581667 20:51576590-51576612 TCTGACCCACACAGCCAACCTGG - Intergenic
1175543054 20:59760172-59760194 CCTGACACCCACACTCATCATGG - Intronic
1178915584 21:36704037-36704059 TCTTTCACCCACACCCATCTTGG - Intronic
1181644648 22:24224831-24224853 ACTGACAGCCTCACCCATCAAGG + Intronic
1182011909 22:27008145-27008167 TCACACACACACACACCTCAGGG + Intergenic
1182221870 22:28765050-28765072 TCTGACAACCCCACCCCTCATGG + Intergenic
1183017239 22:34999142-34999164 GCACACACACACACCAATCAGGG - Intergenic
1183258364 22:36777684-36777706 TAAGACACAGACACACATCAGGG + Intergenic
1184880035 22:47298935-47298957 TGTCTCACACACACCCATTATGG - Intergenic
1184997148 22:48216117-48216139 ACACACACACACACCCCTCATGG + Intergenic
949986456 3:9545052-9545074 CCTGACACACACACACGACACGG + Intronic
950335751 3:12191465-12191487 ACACACACACACACCCCTCATGG - Intergenic
950511456 3:13430803-13430825 TCTGACAAACACACCTGTTATGG + Intergenic
950893031 3:16421952-16421974 TCTGACATACACACCAAGCCAGG + Intronic
952227853 3:31397397-31397419 ACACACACACACACACATCATGG + Intergenic
952674167 3:36007171-36007193 TCACACACACACACCCCTAAGGG + Intergenic
953762625 3:45702308-45702330 TCAAACCCACACAACCATCATGG - Intronic
953804503 3:46056381-46056403 TATGACCCACATACCAATCAAGG + Intergenic
953847967 3:46443876-46443898 TCTGCTGCACACAGCCATCACGG - Intronic
954067578 3:48119084-48119106 TCTCACACACACACCCTGCTTGG - Intergenic
954117080 3:48472974-48472996 TCTCAAACACACACGCAGCATGG + Intronic
954945347 3:54419272-54419294 TCTGCCACCCACACCCAGGAGGG - Intronic
957221361 3:77387184-77387206 TCTAAATCACACACCCACCAGGG - Intronic
960580262 3:119272062-119272084 TCTGACACACACAAACAACTGGG + Intergenic
961357090 3:126346083-126346105 TGTGACACACACACCCATCCAGG - Intronic
961808114 3:129503573-129503595 ACTCACCCACCCACCCATCATGG + Intronic
962067887 3:132002117-132002139 TCTGGCACCCACACCCACTATGG + Intronic
964601543 3:158506336-158506358 TGTGACACATACTCCCATCTCGG - Intronic
965470559 3:169085153-169085175 TTTGCCAAACACACCCATGAAGG - Intronic
967877650 3:194277756-194277778 TCAGAAACATACACCCAGCAAGG + Intergenic
968363229 3:198163738-198163760 CCTGATACAGACAGCCATCAAGG - Intergenic
968789690 4:2650995-2651017 ACTGATACACACACCCCTCCAGG - Intronic
968981271 4:3850967-3850989 TCTGGGTCACCCACCCATCATGG + Intergenic
970094467 4:12446600-12446622 TCAGACATACACACAAATCAAGG + Intergenic
970244053 4:14040213-14040235 TCTGACCCCTACTCCCATCATGG + Intergenic
971001491 4:22327729-22327751 TCTGATAAACACACCCTCCAGGG - Intergenic
971635427 4:29050962-29050984 TCTGACAATCACAACCATCTGGG - Intergenic
972559383 4:40213387-40213409 TCTCACACACACACCCATCTTGG + Intronic
973802389 4:54492079-54492101 TCAGACCCACACACGCCTCAAGG - Intergenic
974266761 4:59595644-59595666 TCTAACATACACATACATCAGGG + Intergenic
977932693 4:102765813-102765835 TCTGACCCCCACTTCCATCAGGG + Intergenic
980703078 4:136457526-136457548 TCTGGCACCCACACCAATCCTGG + Intergenic
981067820 4:140504110-140504132 AGTGTCACAAACACCCATCAAGG + Intergenic
981525992 4:145707600-145707622 TATTAAGCACACACCCATCATGG + Intronic
984094900 4:175422765-175422787 TCTGACACATACCTACATCATGG + Intergenic
985928925 5:3040538-3040560 ACACACACACACACACATCATGG - Intergenic
987105882 5:14638601-14638623 ACACACACACACACTCATCATGG - Intergenic
988712129 5:33789177-33789199 TCTCTCACACACACTCAGCAAGG + Intronic
989402155 5:41019325-41019347 TCTCACACACACACACAAGATGG - Intronic
990339100 5:54804832-54804854 CCTCACACACACCCCCATCACGG + Intergenic
992430290 5:76703937-76703959 TCTGGCACACACTCCCATGATGG - Intronic
992826175 5:80552288-80552310 ACTGACACTCACACCCCACATGG - Intergenic
995242300 5:109899232-109899254 TGTGACGCCCACACACATCAGGG - Intergenic
995280192 5:110326266-110326288 ACACACACACACACACATCAAGG + Intronic
998460634 5:142307562-142307584 TCTGGCACACACCTCCAGCATGG + Intergenic
1000213262 5:159130035-159130057 TCAGCCACCCACACCCTTCATGG - Intergenic
1000439895 5:161251805-161251827 ACTGACTCTGACACCCATCAGGG + Intergenic
1001948595 5:175800178-175800200 CAGGACACACATACCCATCATGG - Intronic
1002106187 5:176880443-176880465 TCTCACACACACCCCCCTCCCGG + Exonic
1007192779 6:40033667-40033689 TCTTACACACACACCCGACCTGG - Intergenic
1008321895 6:50124564-50124586 TATGAGACACAAATCCATCAGGG - Intergenic
1008783237 6:55133391-55133413 ACACACACACACACACATCAAGG + Intronic
1009996533 6:70901477-70901499 TTTGACACACACACCAATGTGGG - Intronic
1011928902 6:92684911-92684933 TCACACACACACACACCTCAAGG - Intergenic
1013239221 6:108228053-108228075 TATGAAACATACACCAATCAAGG + Intronic
1014968442 6:127784536-127784558 TCTCACACACACACAATTCAGGG + Intronic
1015658855 6:135550374-135550396 TTTGACACACCCACACATCACGG - Intergenic
1016403323 6:143704068-143704090 ACACACACACACACCCATGATGG - Intronic
1016808697 6:148238594-148238616 TATGACACATACACACATTAGGG - Intergenic
1018181974 6:161231982-161232004 TCTGATACACACATCCACAATGG + Intronic
1018695899 6:166391220-166391242 TCTGACACACACACCTTGCTGGG - Intergenic
1018837301 6:167494629-167494651 CCTCACACACACACACATCAGGG - Intergenic
1019252451 7:24973-24995 CCTGATACAGACAGCCATCAAGG + Intergenic
1019864082 7:3688812-3688834 TCTGAGGCACACACCGCTCATGG + Intronic
1020786758 7:12583331-12583353 TCTGACACACAGTCACATCTGGG + Intronic
1021142730 7:17047687-17047709 CCTGACCCACAAACCCATCATGG + Intergenic
1021662883 7:22938432-22938454 TCTGACACACAACCAAATCAAGG + Intergenic
1022450050 7:30505584-30505606 TCCCACACACACACACATCCTGG + Intronic
1022869901 7:34465899-34465921 TCTGACCCACACACCATTCCTGG + Intergenic
1023924497 7:44656165-44656187 AGGGACACACACACACATCAAGG - Intronic
1023965721 7:44962257-44962279 TCAGACACCCACATCCAGCAGGG + Intergenic
1024270927 7:47640912-47640934 TCACACACACACACACGTCAGGG - Intergenic
1024386598 7:48759079-48759101 ACACACACACACACCCTTCAGGG + Intergenic
1025006391 7:55358612-55358634 TGTTACACACACACAAATCAAGG - Intergenic
1027852685 7:83468727-83468749 TCTGCCACTCACACCCAGCAGGG + Intronic
1032513573 7:132491029-132491051 TCTCACACACACACCCCTCTGGG + Intronic
1033109405 7:138561305-138561327 TCTTACACACCAACCCCTCAAGG - Intronic
1033501505 7:141954988-141955010 CCTGACCCCCACACCCAACATGG - Intronic
1034294337 7:149958689-149958711 GCTTACATACACACCAATCAAGG - Intergenic
1034486303 7:151366120-151366142 ACTGACAAAGACAGCCATCAAGG - Intronic
1034811732 7:154138183-154138205 GCTTACATACACACCAATCAAGG + Intronic
1035727022 8:1831072-1831094 TCTGACACACAGAGCCTCCAAGG - Intronic
1036029420 8:4951116-4951138 TCTGACACACACCCTCCTCTTGG + Intronic
1036211288 8:6843193-6843215 ACTGACACACACATGCACCAAGG + Intergenic
1036753085 8:11455487-11455509 TCACACTCACACACCCATCAGGG - Intronic
1036753093 8:11455526-11455548 TCAGACTCACACACCCAGCAGGG - Intronic
1036753248 8:11456349-11456371 CCCCACACACACACCCAGCAGGG - Intronic
1036753277 8:11456488-11456510 TCACACTCACACACCCATCAGGG - Intronic
1036753286 8:11456527-11456549 TCACACTCACACACCCAGCAGGG - Intronic
1036944529 8:13082298-13082320 ACACACACACACACACATCAGGG - Intergenic
1037324101 8:17671519-17671541 TCTGAGCCACACTCCCTTCATGG - Intronic
1039000766 8:32977438-32977460 ACACACACACACACCCACCATGG - Intergenic
1040887689 8:52283262-52283284 TCTGACAGTCACCTCCATCATGG - Intronic
1041019874 8:53627725-53627747 TCTGAAACACAAACCCAGCCTGG + Intergenic
1043249126 8:78047807-78047829 TTTTACACACACACACATAATGG + Intergenic
1043917879 8:85944815-85944837 TCACACACACACACTCCTCAGGG + Intergenic
1045382332 8:101639719-101639741 TCTGCCAGACACACTCATCTGGG - Intronic
1045613251 8:103873360-103873382 TCATACAGACACACCCATCCAGG - Intronic
1046583542 8:116123178-116123200 ACACACACACACACACATCAGGG - Intergenic
1048582236 8:135739189-135739211 TCAGACACAGACACACATCCAGG + Intergenic
1049326244 8:142022990-142023012 GCTGACACCCACCCCCACCATGG - Intergenic
1049860548 8:144895345-144895367 TGTGACACACATACCCTTCATGG - Intronic
1050391748 9:5150865-5150887 ACACACACACACACACATCATGG + Intronic
1052452243 9:28646344-28646366 TCTAAGGCACACACACATCACGG + Intronic
1053642986 9:40106176-40106198 ACACACACACACACCCATAACGG + Intergenic
1054163846 9:61700993-61701015 ACAGACACACACACACATAAAGG + Intergenic
1054541774 9:66270427-66270449 ACACACACACACACCCATAATGG - Intergenic
1054765330 9:69038035-69038057 ACTGACAAACACACCCAACTTGG + Intronic
1055345608 9:75334146-75334168 ACACACACACACACACATCATGG + Intergenic
1055593652 9:77843883-77843905 TCTGAGCCACAGACCCATCCAGG - Intronic
1056233572 9:84570409-84570431 TCACACACACACACCCCTCAGGG + Intergenic
1056635656 9:88329192-88329214 TCTCACACACACACACAAAAGGG + Intergenic
1056888291 9:90465439-90465461 ACACACACACACACACATCAAGG + Intergenic
1057214107 9:93218743-93218765 CCAGACACACACCCCCAACATGG - Intronic
1058751474 9:108042511-108042533 TCTGACACTCACAAATATCATGG - Intergenic
1059597687 9:115740523-115740545 ACACACACACACACACATCATGG + Intergenic
1060405750 9:123372326-123372348 ACTCACACACAAAGCCATCAGGG - Exonic
1060887614 9:127166815-127166837 TCTTACACACCCCACCATCATGG - Intronic
1061883257 9:133578460-133578482 TCTCACACACACACTCTTCCGGG - Exonic
1061953177 9:133947789-133947811 TCTCACACACACACTCACAAAGG - Intronic
1062053921 9:134461044-134461066 GCTGACAGCCACACCCATCCAGG - Intergenic
1062747916 9:138227398-138227420 CCTGATACAGACAGCCATCAAGG - Intergenic
1185619238 X:1443264-1443286 TTGGACACACACCGCCATCATGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619283 X:1443556-1443578 TTGGACACACACCGCCATCATGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185692832 X:2170460-2170482 ACACACACACACACACATCATGG - Intergenic
1186329280 X:8514869-8514891 TCTGACAAACTCACCCGGCAGGG - Intergenic
1187999885 X:24970970-24970992 TCTGACACTCAAACCAAGCAAGG + Intronic
1188801270 X:34533217-34533239 TAGAACACACACACACATCAGGG + Intergenic
1190165578 X:48070861-48070883 TCTGAAAAAGCCACCCATCATGG + Intronic
1194337187 X:92662838-92662860 TGTGGCACACACACACACCATGG + Intergenic
1197007994 X:121526574-121526596 TCACACACACACACACATCTTGG + Intergenic
1197206253 X:123793148-123793170 CCTGAAACACTCACCCCTCATGG - Intergenic
1197888164 X:131239586-131239608 CCTGACACTCACACCCACCATGG - Intergenic
1199349327 X:146781927-146781949 TATCACACACACACACATCACGG - Intergenic
1201756913 Y:17496328-17496350 TCTGACAAACACAAGCAACAGGG + Intergenic
1201844640 Y:18409656-18409678 TCTGACAAACACAAGCAACAGGG - Intergenic
1201888692 Y:18917462-18917484 TCTGACCCCCTCATCCATCATGG - Intergenic