ID: 907966062

View in Genome Browser
Species Human (GRCh38)
Location 1:59331026-59331048
Sequence CAGGATATGTTCTCTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907966060_907966062 -7 Left 907966060 1:59331010-59331032 CCACGTCTCTCTTGACCAGGATA 0: 1
1: 0
2: 1
3: 2
4: 85
Right 907966062 1:59331026-59331048 CAGGATATGTTCTCTGTGTCTGG 0: 1
1: 0
2: 0
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907966062 Original CRISPR CAGGATATGTTCTCTGTGTC TGG Intronic
900457585 1:2785044-2785066 CAGGGCATGCTCTCTGTGCCAGG + Intronic
900985286 1:6069607-6069629 TAGAAAATGATCTCTGTGTCTGG + Intronic
901411082 1:9084639-9084661 CAAGATATGTTATCTGGATCTGG - Intronic
902122705 1:14181291-14181313 CAGGAAATGTTCTGTGGGTTTGG + Intergenic
904333084 1:29778174-29778196 CAGTATTTGTTCTTTGTGACAGG + Intergenic
906445109 1:45889567-45889589 CACAATGTGTTCTCTGTGCCTGG + Intronic
907966062 1:59331026-59331048 CAGGATATGTTCTCTGTGTCTGG + Intronic
908634857 1:66152253-66152275 CAAGCTTTGTTCTCTGTATCTGG + Intronic
908776000 1:67640686-67640708 CAGGATTTGTTCTTTTTGACTGG - Intergenic
912693511 1:111822458-111822480 CAGTATTTGTCCTTTGTGTCTGG + Intronic
912865090 1:113249391-113249413 CAGGCCATGTTGTCAGTGTCTGG + Intergenic
915102902 1:153513516-153513538 CATGTTATCTTCCCTGTGTCTGG - Intergenic
916232186 1:162551402-162551424 CAGGATTTGTTTTATGTGCCAGG + Intergenic
916888600 1:169095074-169095096 CATGCTATTTCCTCTGTGTCTGG - Intergenic
918710933 1:187729172-187729194 CAATATTTGTCCTCTGTGTCTGG - Intergenic
921256896 1:213349880-213349902 TAGGAAATTTTCTCTGTCTCTGG - Intergenic
921508430 1:216003049-216003071 CAGGATTTGTTATCCGTGCCCGG + Intronic
922926676 1:229353038-229353060 CAGTATTTGTCCTTTGTGTCTGG + Intergenic
924011173 1:239666606-239666628 CAGGAAATGTTATCTATTTCAGG - Intronic
1067738627 10:48878551-48878573 ATGGAAATGTGCTCTGTGTCTGG - Intronic
1068265768 10:54647233-54647255 CAGTATTTGTTCTCTGTGACTGG - Intronic
1069511435 10:69045597-69045619 CAGGATCAGTTCTCTGGGCCAGG - Intergenic
1070635638 10:78125113-78125135 GAGGGTATGTTCTCTGGGTGAGG - Intergenic
1070727189 10:78800405-78800427 CAGGATTTGTTCTCAGGGGCTGG + Intergenic
1070869086 10:79732414-79732436 CAAGATTTGTTCTCTGTATGAGG - Intergenic
1070959013 10:80485963-80485985 CAGGATACGTTGTCTGGGTGTGG + Intronic
1071636000 10:87254599-87254621 CAAGATTTGTTCTCTGTATGAGG - Intergenic
1071659241 10:87483345-87483367 CAAGATTTGTTCTCTGTATGAGG + Intergenic
1074152871 10:110773721-110773743 CAGGATCAGTTCTCTTTGGCAGG + Intronic
1074634651 10:115300990-115301012 CAGTATATGTGCTTTGTGACTGG + Intronic
1075127799 10:119714605-119714627 CAGGACAAATTCTCTGTCTCTGG + Intergenic
1077722575 11:4643341-4643363 CAGGCTCTGGTCCCTGTGTCTGG - Intergenic
1078485632 11:11720808-11720830 CAGGATAATCTCTCTGTCTCAGG + Intergenic
1078821017 11:14882168-14882190 CAGGCAATGTTCTAAGTGTCAGG + Intronic
1079720584 11:23807098-23807120 TAGGAATTGTTCTCTGTGTTGGG - Intergenic
1080448455 11:32358795-32358817 CAGGGCTTGTTCTCTGTTTCTGG - Intergenic
1080664662 11:34325167-34325189 TAGGATATCTTCTTTGTGTCAGG - Intronic
1080977944 11:37364668-37364690 GAGGAGATGTTCTGGGTGTCAGG - Intergenic
1086256247 11:84880140-84880162 CAGTATTTGATCTCTCTGTCTGG - Intronic
1087509504 11:99072980-99073002 CAGCATATATTCTCTATTTCTGG + Intronic
1090146689 11:124331655-124331677 TAGCATATGTTCTTTGTGACTGG - Intergenic
1090932552 11:131311294-131311316 CAGGATATTTTCTGAGTATCAGG - Intergenic
1091686267 12:2565041-2565063 CTGTATATTTTCTCTGTATCAGG + Intronic
1097597069 12:61647026-61647048 CAGGATATTTACTCAGTGTTTGG - Intergenic
1098027381 12:66218919-66218941 CAGTATTTGTCTTCTGTGTCTGG + Intronic
1099415226 12:82376634-82376656 AAGGATAGGTTCACTGTGTTTGG - Intronic
1099420579 12:82454208-82454230 AAGGAAAAGTTCTCTGTGTTAGG + Intronic
1099750042 12:86761942-86761964 TAGGACATGTTATCTTTGTCAGG + Intronic
1100783572 12:98055373-98055395 CAGAGTATGTGCTCTATGTCAGG - Intergenic
1104268190 12:127257632-127257654 CAGGATCTGTGCCCTGAGTCTGG + Intergenic
1106013423 13:25846200-25846222 AAGAATATGTTCTCTATGCCAGG + Intronic
1107112589 13:36714134-36714156 CAGGATGTCTGCTGTGTGTCAGG + Intergenic
1107507612 13:41050259-41050281 CAGTATATCTTCTTTGTGACTGG + Intronic
1111633257 13:90870573-90870595 CAGTATTTGTCCTCTGTGCCTGG + Intergenic
1111634594 13:90887708-90887730 CACATCATGTTCTCTGTGTCAGG - Intergenic
1112217402 13:97447463-97447485 CTAGATATTTTCTATGTGTCAGG - Intronic
1112388722 13:98963331-98963353 CAGGAAATGTTCTTAGTGCCAGG + Intronic
1112926554 13:104682343-104682365 TAGGATATTTTCTCTGTGCCGGG - Intergenic
1113484295 13:110642989-110643011 CAGGATCTGTTCTCAGTGGGAGG - Intronic
1117674140 14:58138950-58138972 CAGGAGATATTCTCTCTGGCTGG + Exonic
1119376924 14:74202083-74202105 TAAGATATGTACTCAGTGTCAGG - Intergenic
1121161716 14:91748958-91748980 CAGTATTTGTTTTCTGTGCCTGG + Intronic
1122344613 14:101050794-101050816 CAGGATGTGGTCCCTGTGTGGGG + Intergenic
1123678261 15:22734911-22734933 CTGGATATCTGCTCTGTGTAAGG + Intergenic
1124330453 15:28809178-28809200 CTGGATATCTGCTCTGTGTAAGG + Intergenic
1124415356 15:29469149-29469171 CAGGATTTGTCCTCTGTGACTGG - Intronic
1125540173 15:40465752-40465774 CAGGCTATCTTCTCTGTCACTGG - Intronic
1125738226 15:41943357-41943379 CAGCATCTGTTCTCTGTGGCTGG - Intronic
1125776894 15:42224074-42224096 CAGGACATGTTATGGGTGTCGGG - Intronic
1126334597 15:47573031-47573053 CAATAAATGTTCTCTGTGCCCGG + Intronic
1127193263 15:56555592-56555614 TAGTATTTGTCCTCTGTGTCTGG + Intergenic
1127371289 15:58344236-58344258 CAGAATATGTCCTATGTGTTTGG - Intronic
1127454765 15:59146976-59146998 CAGGAAATGTTATTTGTTTCTGG - Intronic
1131189873 15:90305931-90305953 CTGGATATGTTCTTTGTGTAAGG - Intronic
1131744171 15:95428154-95428176 CAGTATTTGTTTTCTGTGTCTGG - Intergenic
1131766102 15:95677416-95677438 GATAATATGTTCTCTGTGTGAGG + Intergenic
1134888138 16:17813026-17813048 CCTGATAGGTTCTCTGTGTATGG - Intergenic
1135723724 16:24838433-24838455 CAGAATATGTTCTGTGTGGCTGG + Intergenic
1137798121 16:51239019-51239041 CAGGATGTGTTCACTGAGTGAGG - Intergenic
1138442954 16:57046147-57046169 CAGGATAGGATCTCTGTTTCTGG + Intronic
1139732627 16:68959678-68959700 TAGGAGATGTGCCCTGTGTCTGG - Intronic
1141570770 16:84932402-84932424 CAGGCCCTGATCTCTGTGTCGGG + Intergenic
1144295062 17:13866399-13866421 CAGGATGAGTTCCCTGTCTCAGG - Intergenic
1146559045 17:33852298-33852320 CAGGATGTTTTCTTTGTGGCAGG + Intronic
1149573139 17:57689782-57689804 CAGGATGGATTCTTTGTGTCTGG + Intergenic
1150568203 17:66361822-66361844 CTGAACATGTTCTCTGCGTCAGG + Intronic
1153367946 18:4280311-4280333 CAGGAACTGTTCTTAGTGTCTGG + Intronic
1155376380 18:25162763-25162785 AAGGAAGTGATCTCTGTGTCTGG + Intronic
1157288930 18:46396423-46396445 CAGGAGACCTGCTCTGTGTCTGG - Intronic
1160218228 18:76952901-76952923 CAGGACCTGTGCTCTGTGCCAGG - Intronic
1161011810 19:1963081-1963103 CACGGCATGTCCTCTGTGTCTGG - Intronic
1161765470 19:6205486-6205508 CAGGGTATGTTGTGAGTGTCAGG + Intergenic
1162561931 19:11422125-11422147 CAGGATAGGTCTTCTGTCTCGGG + Intronic
1164493597 19:28736917-28736939 CAGAATATGTGCTGTCTGTCTGG - Intergenic
1164879357 19:31718141-31718163 CATAATATTTTCTCTGTGTCAGG - Intergenic
1165989600 19:39802282-39802304 CATGATCTGTTCTGGGTGTCAGG - Intergenic
1166043725 19:40217736-40217758 CAGGAAATGGTCTTTGGGTCGGG - Intronic
1166311450 19:41965208-41965230 CAGCATGTGATCTCTGTGTCTGG - Intergenic
1166458389 19:42964317-42964339 CAGAATTTGTACACTGTGTCTGG + Intronic
1166475335 19:43119574-43119596 CAGAATTTGTACACTGTGTCTGG + Intronic
1167172905 19:47845298-47845320 CAATATATGGTCTTTGTGTCTGG - Intergenic
925349035 2:3188455-3188477 CGGGGTCTGTTCTCTGTGTCTGG - Intergenic
925837717 2:7962276-7962298 CAGCATCTGTTGTCTGAGTCAGG + Intergenic
926333311 2:11843888-11843910 TTGGATATGTACTCTGTGTCAGG - Intergenic
928136097 2:28688526-28688548 CAGGATATGTCCTGGTTGTCTGG - Intergenic
928686500 2:33755371-33755393 AAGGAGATGTTCTCTGTTTTAGG + Intergenic
930289325 2:49473682-49473704 TAGGATATTTACTCTGAGTCAGG + Intergenic
932711982 2:74072843-74072865 CAGTATTTGTCCTTTGTGTCTGG + Intronic
937311411 2:120905572-120905594 TGGGATGAGTTCTCTGTGTCTGG + Intronic
937518918 2:122687043-122687065 CAGTATTTGTTTTCTGTGTCTGG - Intergenic
938557593 2:132439808-132439830 CAGGATATGTTTTGTTTGTTTGG + Intronic
939012053 2:136858231-136858253 CAGCATATTTTCACTGTTTCTGG + Intronic
939965226 2:148604045-148604067 ATGGACATGTTCTCTGTGTGAGG - Intergenic
941358922 2:164528062-164528084 CAGTATATACTATCTGTGTCTGG - Intronic
944061113 2:195569565-195569587 TAGGAGATCTTCTATGTGTCAGG - Intergenic
944451602 2:199849904-199849926 CAGGTAATGTTCCCTGTGTGAGG + Intronic
944881131 2:204014101-204014123 CATTATATATTCTGTGTGTCGGG + Intergenic
945832636 2:214805494-214805516 AAGGATAGGTTCTCTGACTCCGG - Intronic
947163872 2:227241761-227241783 CTGCATATGTACTCTGTGCCAGG + Intronic
948285171 2:236778629-236778651 CAGTATTTGCTTTCTGTGTCTGG + Intergenic
948796151 2:240402887-240402909 CAGGAAAGGTCCTCAGTGTCTGG + Intergenic
1168830032 20:840933-840955 CAGGTGATGTTCACTGTGCCAGG - Intronic
1169106786 20:3002985-3003007 CAGATGCTGTTCTCTGTGTCTGG + Intronic
1170093989 20:12624697-12624719 CAGGATTTTTTTTCTTTGTCTGG + Intergenic
1174479050 20:50818189-50818211 CAGGATATCGTCTCTTTTTCAGG + Exonic
1177075917 21:16573253-16573275 TAGGATAAGTAGTCTGTGTCAGG - Intergenic
1181307622 22:21925972-21925994 AAGGATCTGCTGTCTGTGTCGGG - Intronic
1182800842 22:33031023-33031045 CAGGGCCTGTTCTCTGTGCCTGG - Intronic
1182941725 22:34283422-34283444 CAGAATATCTCCTCTGTCTCAGG + Intergenic
1183054259 22:35292989-35293011 CAGGGTATGGTGGCTGTGTCTGG + Exonic
1183730001 22:39613088-39613110 CAGGAGATGATTTCTGTGTGTGG - Intronic
949247634 3:1943744-1943766 CAGGAGAAATTCTCTGTGCCTGG + Intergenic
950449377 3:13057116-13057138 CAGGATAAGGCCTCTGTGTAAGG - Intronic
951153562 3:19322399-19322421 CAGCATCTTTTGTCTGTGTCTGG + Intronic
951786846 3:26430422-26430444 CAGGATATGTTCAGTGAGTAAGG + Intergenic
952300674 3:32102159-32102181 CAGGATATGTCCACAGTGTTGGG + Intergenic
952488896 3:33846354-33846376 CTGGATATCTGCTCTGTGTAAGG + Intronic
953951660 3:47195510-47195532 CAGTATTTGTTCTTTTTGTCTGG + Intergenic
955795916 3:62636867-62636889 CAGAATATGTCCTCTGGCTCTGG + Intronic
955971431 3:64442308-64442330 CAGCATTTGGCCTCTGTGTCAGG + Intronic
956808513 3:72841478-72841500 CAGTATGTGTTCTTTTTGTCTGG - Intronic
958044898 3:88271600-88271622 CAGTATATATACTCTGTGTTTGG + Intergenic
958124728 3:89341294-89341316 CAGAAAATGTTCTCTCTTTCAGG - Intronic
960192040 3:114718294-114718316 CTGAATATGTTTTCTGTGTTAGG + Intronic
961845054 3:129755722-129755744 CAGGATTTGTTGTCTGTTTCTGG - Intronic
961915835 3:130374032-130374054 TAGAATTTGTTTTCTGTGTCGGG - Intronic
962356693 3:134700216-134700238 CAGGATATGTTCGCAATGTTTGG - Intronic
963574418 3:147041920-147041942 GAGGAAATGTTCTCTTTGTATGG + Intergenic
963835582 3:150055209-150055231 CAGGATATGCTCACTGAGGCTGG + Intergenic
964013143 3:151914715-151914737 CAGGATATTTTCTCTTATTCAGG - Intergenic
964581966 3:158249368-158249390 CAGGATATGTACTTTCTGTCTGG + Intronic
968826276 4:2899996-2900018 CAGGATGTGTTCTGTGTTACAGG + Intronic
970422678 4:15919953-15919975 CAGGAAATGATCTCTGTCTCTGG - Intergenic
972733495 4:41817776-41817798 GAGGATCTGTTCCCTGTCTCTGG - Intergenic
972995197 4:44870513-44870535 CAGGAGGTTTTCTCTGTGGCAGG - Intergenic
974149635 4:57990093-57990115 CAAAATATGTTCTCTGTGGTAGG + Intergenic
974581455 4:63808840-63808862 CAGGATATGTTATTTGTCTAAGG - Intergenic
974649486 4:64735415-64735437 CAGGAAATATTCTCTCTGTAGGG + Intergenic
974787728 4:66642189-66642211 CATTGTATGTTCTCTGAGTCAGG + Intergenic
975454139 4:74569661-74569683 TAGAATATTTTTTCTGTGTCTGG - Intergenic
978463120 4:108979779-108979801 CAGGCGATGTACTCTGAGTCTGG + Intronic
978534953 4:109750999-109751021 CAGTATATAATCTCTGAGTCGGG + Intronic
978595688 4:110374600-110374622 CAGGATATCTGCTCTGCCTCTGG - Intronic
980886821 4:138771644-138771666 CAGCAAATGTCATCTGTGTCGGG - Intergenic
981392400 4:144206670-144206692 CTGGTTCTGTTCTCTGTGGCTGG - Intergenic
982209593 4:153023617-153023639 GAGCATATGTGCTCTGTGGCAGG - Intergenic
983735944 4:171060355-171060377 CTGGATATGTTCTTTGTGTTAGG + Intergenic
984082225 4:175261702-175261724 CAGGAAATCTTGTGTGTGTCTGG - Intergenic
984749072 4:183254169-183254191 CAGGATAAGTTCTGTGTTTTAGG + Intronic
994892014 5:105647983-105648005 CGGGCTATGTGCTCTGTCTCAGG - Intergenic
997838049 5:137212501-137212523 CTGAATATGTACTATGTGTCAGG + Intronic
998200640 5:140115205-140115227 CAGTATATTTTCTGTGTGTGTGG - Exonic
998519375 5:142785896-142785918 CATCATTTGTTCACTGTGTCTGG + Intronic
998554674 5:143111827-143111849 CATTATATGCTGTCTGTGTCAGG + Intronic
999090006 5:148927674-148927696 CAGGACATTTTCTCTTTGTAAGG - Intronic
1001263464 5:170253957-170253979 CAGGGTATTTTCTATGTGCCAGG + Intronic
1002691220 5:181052215-181052237 CGGCATTTGTTCTGTGTGTCTGG - Intronic
1004276040 6:14235988-14236010 CTGGATCTGTTCTCTCTGCCTGG - Intergenic
1004286913 6:14329714-14329736 CAGTATAAGATATCTGTGTCTGG + Intergenic
1005130179 6:22497957-22497979 CTGGATATTTGCTGTGTGTCAGG + Intergenic
1006416523 6:33907439-33907461 GAGGATATTTTCTGAGTGTCTGG + Intergenic
1009467934 6:63996218-63996240 CAGTATTTGTACTCTGTGGCTGG - Intronic
1010173037 6:72994947-72994969 CAGGATATTTTTTCTCTCTCTGG - Intronic
1013033492 6:106359095-106359117 CACAATATGTACTCTGTTTCTGG - Intergenic
1013249779 6:108322518-108322540 CAGGAGATGTAATATGTGTCTGG + Intronic
1015621555 6:135137206-135137228 CAGTAAATGTTCTCTGTGCAGGG - Intergenic
1016574836 6:145558018-145558040 CAGTATTTGTTTTCTGTGCCTGG + Intronic
1018002238 6:159589538-159589560 CAGGAGATGTGCACTGTGTAAGG - Intergenic
1018362060 6:163080509-163080531 CAGGTTTCATTCTCTGTGTCTGG + Intronic
1018854673 6:167666989-167667011 CAGGATTTGTCCTCTGTGGCTGG - Intergenic
1021856189 7:24858857-24858879 CAGGACATTTCCTCTGTGTAGGG + Intronic
1022360422 7:29651246-29651268 AAGGATATGTTATCTGAATCAGG + Intergenic
1024432591 7:49306703-49306725 CAGGATTTGTCTTTTGTGTCTGG + Intergenic
1024496092 7:50047448-50047470 TTGTATATGTACTCTGTGTCTGG - Intronic
1026874703 7:73872430-73872452 CAGGCTTTCTTCTCTGAGTCTGG - Intergenic
1030160501 7:106503572-106503594 CAGGACATTTGCTCTGTGCCAGG + Intergenic
1031656350 7:124360831-124360853 CTGCATATCTTCTCTGTGGCCGG + Intergenic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1039105745 8:33987545-33987567 CAAGAGATGTTGACTGTGTCAGG + Intergenic
1039651372 8:39342536-39342558 CAGAATTTGTTTTCTGTGCCTGG - Intergenic
1040394330 8:46981388-46981410 AAATATATTTTCTCTGTGTCAGG - Intergenic
1040706198 8:50131418-50131440 CAGTATTTTTTTTCTGTGTCTGG + Intronic
1040727671 8:50402303-50402325 CAGGATGTGATATGTGTGTCTGG + Exonic
1048475373 8:134737935-134737957 CAGGAGATCTTTTTTGTGTCTGG + Intergenic
1050231578 9:3530985-3531007 TATGCTATGTACTCTGTGTCTGG - Intergenic
1050296640 9:4211912-4211934 CAGTTTATGGTCTTTGTGTCTGG - Intronic
1052266060 9:26574969-26574991 CAGAATATGTGGTCTGTGTGTGG + Intergenic
1052473314 9:28927099-28927121 AAAGATATGTTCTCTTTTTCAGG - Intergenic
1055822811 9:80288132-80288154 AAGGATATCTTCTCTGTAGCAGG - Intergenic
1056104785 9:83336447-83336469 CAGCTAATATTCTCTGTGTCAGG + Intronic
1057388566 9:94624978-94625000 CAGGATAACTTGTCTGTCTCTGG - Intronic
1059095217 9:111406264-111406286 TAGGATATTTGCTCTGTGCCTGG - Intronic
1059614747 9:115937147-115937169 AAGGATATTTTGTATGTGTCTGG + Intergenic
1059649382 9:116301194-116301216 CAGGATATGTTCCTTTTGTCTGG + Intronic
1059667247 9:116460142-116460164 CAATATATGTCCTTTGTGTCTGG - Intronic
1059989545 9:119852387-119852409 CTGGGTATGTTCTGTGTTTCTGG + Intergenic
1060769297 9:126319612-126319634 CGGGGTATTTCCTCTGTGTCAGG - Intergenic
1061892177 9:133628484-133628506 CAGGATTTATCCTTTGTGTCTGG - Intergenic
1203375599 Un_KI270442v1:373592-373614 TAGGATGTTTACTCTGTGTCTGG - Intergenic
1186184927 X:7011381-7011403 CAGCATTTGTACACTGTGTCTGG + Intergenic
1186259250 X:7758588-7758610 CAGTATTTGTCCTCTGTGTCTGG + Intergenic
1187101049 X:16192407-16192429 CAATATGTATTCTCTGTGTCTGG + Intergenic
1189280184 X:39815780-39815802 CAGGATATCTTGTCTGTGATTGG + Intergenic
1190301047 X:49057802-49057824 CAGGATGTGTGCTGTGTGCCGGG + Intronic
1190445215 X:50517110-50517132 CAGGGTACCTGCTCTGTGTCTGG - Intergenic
1190591169 X:52003091-52003113 CAGTATTTGCTTTCTGTGTCTGG + Intergenic
1191167587 X:57406577-57406599 AAGGTTATGATCCCTGTGTCAGG - Intronic
1191188915 X:57644694-57644716 CTGGATAGGTTGTATGTGTCTGG - Intergenic
1192542022 X:71982216-71982238 CAGTATATGGGCTTTGTGTCTGG - Intergenic
1192875837 X:75228900-75228922 CAGTATCTTTTTTCTGTGTCTGG - Intergenic
1195634970 X:107103729-107103751 CAGTATATGTTCTTTGTGTAAGG - Intronic
1198724985 X:139667596-139667618 CAGGCTATGTGCTCTGTCTCAGG + Intronic
1199854197 X:151746563-151746585 CAGTATTTGTCCTTTGTGTCTGG + Intergenic
1200977057 Y:9224008-9224030 CATGACTTGTTCCCTGTGTCGGG - Intergenic
1201718495 Y:17072626-17072648 AAGAATCTCTTCTCTGTGTCTGG + Intergenic
1201719474 Y:17080968-17080990 AAGAATCTGTTCTCTGTGCCTGG + Intergenic
1201950888 Y:19562693-19562715 CAGGATTTGTGCTCTGTGCTTGG - Intergenic