ID: 907966322

View in Genome Browser
Species Human (GRCh38)
Location 1:59333402-59333424
Sequence GGTGTGATGAGCTCAACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907966322_907966325 6 Left 907966322 1:59333402-59333424 CCAGATGTTGAGCTCATCACACC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 907966325 1:59333431-59333453 TGCTGAATTCTCATATCATTGGG 0: 1
1: 0
2: 1
3: 13
4: 167
907966322_907966327 21 Left 907966322 1:59333402-59333424 CCAGATGTTGAGCTCATCACACC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 907966327 1:59333446-59333468 TCATTGGGAGATGCAGGTTTAGG 0: 1
1: 0
2: 0
3: 21
4: 209
907966322_907966324 5 Left 907966322 1:59333402-59333424 CCAGATGTTGAGCTCATCACACC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 907966324 1:59333430-59333452 TTGCTGAATTCTCATATCATTGG 0: 1
1: 0
2: 0
3: 15
4: 159
907966322_907966326 15 Left 907966322 1:59333402-59333424 CCAGATGTTGAGCTCATCACACC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 907966326 1:59333440-59333462 CTCATATCATTGGGAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907966322 Original CRISPR GGTGTGATGAGCTCAACATC TGG (reversed) Intronic
901822930 1:11841741-11841763 AGTGTGCTGAGCGCAAGATCTGG - Exonic
903429364 1:23280989-23281011 GGTGAGAGGTGCACAACATCAGG + Intergenic
905684449 1:39898778-39898800 GGTGTTATGAGCCCCATATCTGG - Intronic
907966322 1:59333402-59333424 GGTGTGATGAGCTCAACATCTGG - Intronic
909050814 1:70766051-70766073 AGTGTCATGAGATCAGCATCTGG + Intergenic
910035181 1:82780092-82780114 AGTGTCATGAGATCAGCATCTGG + Intergenic
912533471 1:110343534-110343556 GGTGAGATGATATCAACCTCTGG + Intronic
918635504 1:186769420-186769442 GGTGAGAGGAGAACAACATCCGG - Intergenic
922345934 1:224696380-224696402 TGTGTGCTCAGCTCAACATCAGG + Intronic
922752537 1:228077272-228077294 GGTGTGATGAGGACACCAGCAGG - Intergenic
1063966340 10:11349213-11349235 AGTGTCATGAGATCAGCATCTGG - Intergenic
1067254650 10:44624834-44624856 GCTGTGATGAGATCATCTTCCGG - Intergenic
1069152521 10:64981926-64981948 AGTGCGATGAGTTCAATATCAGG - Intergenic
1070278242 10:75028851-75028873 GGTTTGATGAGATCATCTTCTGG - Exonic
1074551889 10:114451392-114451414 GGTTTGATGGGCTCAGCAACAGG + Intronic
1075650204 10:124122949-124122971 GAAGTGCTGAGCACAACATCTGG - Intergenic
1077316085 11:1919970-1919992 GGTGTGATGGTCTCAGCACCGGG + Intronic
1077664984 11:4099729-4099751 GATGTGATAAAATCAACATCTGG + Intronic
1079444444 11:20546385-20546407 GGGATGCTGAGCTCAACCTCTGG + Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1093779097 12:23113284-23113306 GTTTTGATGAGCTCAACACATGG - Intergenic
1095473776 12:42564836-42564858 GTGGTGTTGAGCTCTACATCTGG - Intronic
1102588967 12:113943012-113943034 GGTGAGATGAGCTCAGCATGGGG - Intronic
1103136352 12:118511142-118511164 GCTGTGAAGAGCTCTACAACTGG + Intergenic
1107778173 13:43870314-43870336 GGAGTGAATAGCTCAGCATCAGG - Intronic
1108121185 13:47189250-47189272 GGTGTGATGAGAGCAGCCTCTGG + Intergenic
1109119416 13:58435247-58435269 AGAGCGTTGAGCTCAACATCTGG + Intergenic
1114318171 14:21525754-21525776 GGGGAGATGAGCTCACCATCAGG + Intronic
1115154203 14:30319995-30320017 GTTGTGATAGTCTCAACATCTGG + Intergenic
1117075765 14:52102478-52102500 TGTGGGACAAGCTCAACATCAGG - Intergenic
1118477849 14:66135075-66135097 AGTGTGATGAGCTCCCCATAAGG + Intergenic
1121477743 14:94227495-94227517 GTTGTGCTGACTTCAACATCTGG - Intronic
1122367670 14:101203794-101203816 GGTGTGAAGAGCTCAGAACCAGG - Intergenic
1126963882 15:54029325-54029347 AGTGTGATGAACTCAAGATTAGG + Intronic
1129595973 15:76964642-76964664 GGTGAGATGAACTCAGCAGCTGG + Intergenic
1131297799 15:91167214-91167236 TGTCTGATAATCTCAACATCTGG + Intronic
1135196246 16:20397572-20397594 AGTGTGATGAGGTCAGCTTCAGG - Intronic
1136929503 16:34406598-34406620 GGTGTGTAGAGCTCAGCATCAGG - Intergenic
1136975071 16:35005206-35005228 GGTGTGTAGAGCTCAGCATCAGG + Intergenic
1138427667 16:56947008-56947030 GGTGTGATGAGTTCAAGGACAGG + Intergenic
1141206238 16:81935143-81935165 AGTATCATGAGGTCAACATCAGG + Intronic
1142135917 16:88452051-88452073 TGTGCGATGATCTCATCATCAGG + Intergenic
1150574047 17:66414096-66414118 GGTTTCAGGAGCTCTACATCAGG + Intronic
1152590855 17:81211291-81211313 GGTGTGGGGAGCACAACAGCAGG + Intronic
1152638842 17:81441171-81441193 GGTGTGGGGAGCTGAACATGGGG + Intronic
1155626238 18:27838167-27838189 GATATGATCAGCTTAACATCTGG + Intergenic
1158584889 18:58723955-58723977 GTTCAGATGAGCTCAACAGCTGG - Intronic
1162991965 19:14309111-14309133 GGTGACATGATCTCAGCATCTGG - Intergenic
1163533515 19:17864059-17864081 GCTGTCTTGATCTCAACATCGGG + Intronic
1164217493 19:23162458-23162480 GGTGAGATGTGCTCAAAATGAGG + Intergenic
1164616773 19:29671841-29671863 GGTGTGATCAGCTCAGCCCCAGG + Intronic
1167414602 19:49363471-49363493 GGGGTGATGAGGGCAAGATCTGG + Intronic
926664904 2:15510489-15510511 AGAGTCATGATCTCAACATCAGG + Intronic
930567226 2:53036235-53036257 GTTGTGATGAGTCCAACATTTGG - Intergenic
931652713 2:64482983-64483005 GGTGTGATGACTCCAACATCAGG - Intergenic
939410892 2:141823377-141823399 GGTGGAAAGTGCTCAACATCTGG + Intronic
944526276 2:200623384-200623406 GGAGAGATGTGCTCACCATCAGG + Intronic
945691497 2:213042225-213042247 GGTGTGATGAGCACAAATTGTGG + Intronic
947134706 2:226965526-226965548 GGTGTGAAGAGGTCAGCTTCTGG + Intronic
947665313 2:231901547-231901569 TGTGTTATTAGCTCAACACCTGG - Intergenic
1170673107 20:18453356-18453378 GGTGTGAAGGGATCAGCATCAGG - Intronic
1170693616 20:18637462-18637484 GGAGAGATGAGCCCAACATGTGG + Intronic
1171351683 20:24507455-24507477 GCTGTGATGAGCTCAGCACAAGG + Intronic
1174597514 20:51695795-51695817 GCTGTGTTAAGCTCAACCTCAGG - Intronic
1175321734 20:58092974-58092996 GGGGTGGTGAGCTCAAGTTCTGG + Intergenic
1175695568 20:61100614-61100636 GGGGTGATGAACTCAGCATGAGG + Intergenic
1178265647 21:31140884-31140906 AGGGTGAGGAGCTGAACATCAGG + Intronic
1178808235 21:35857466-35857488 ACTCTGATGAGCTCAACATATGG + Intronic
1180143191 21:45905423-45905445 AGTGTGATGAGTTCTGCATCTGG + Intronic
1181148809 22:20867888-20867910 GATGGGAGGAGCTCACCATCAGG + Intronic
1185324834 22:50220487-50220509 GGTGTGTTGGGCTCAGCTTCTGG + Exonic
953403449 3:42647404-42647426 GTGGTGCTGAGCTCTACATCAGG - Exonic
953533017 3:43755232-43755254 GGTGAGATGAGCTAGAGATCAGG - Intergenic
954743751 3:52774960-52774982 GGTGTGATGAGTTCAAGACTGGG - Intergenic
955839440 3:63096542-63096564 GGTGTGCTGAGCTCAGCCTATGG - Intergenic
957114428 3:76006444-76006466 GGTGTGATGAGATCAGCATTCGG + Intronic
958923754 3:100135363-100135385 GGTGACATGACCTCAACTTCAGG - Intronic
959121407 3:102236947-102236969 GATGTGATAAGTACAACATCGGG - Intronic
961999826 3:131284392-131284414 GCTGTGATGATCTCATCCTCTGG + Intronic
965320447 3:167247188-167247210 GATGTGCTGCTCTCAACATCTGG - Intronic
966338422 3:178897862-178897884 GGTGTGATCACCTCAACCTCAGG + Intergenic
969960831 4:10943471-10943493 GGTGTGATGAGCTGATCCCCAGG + Intergenic
971109765 4:23572352-23572374 GGTGTTAAGATTTCAACATCTGG - Intergenic
972170065 4:36334924-36334946 GGTATGATGTGCTTAACATGTGG + Intronic
975536729 4:75459096-75459118 GGCTTGAGGAGCTCTACATCAGG - Intergenic
976815267 4:89140325-89140347 AGTGTGAAGGTCTCAACATCAGG + Intergenic
985271861 4:188200924-188200946 GCTGTGATGAGCTGAACGTGTGG - Intergenic
987242749 5:16017456-16017478 GGTGTGTTGTGATCAACATATGG + Intergenic
987324052 5:16795958-16795980 GGTGCGAGGATCTCAAGATCAGG + Intronic
991054694 5:62307298-62307320 GGTGTGAAAATATCAACATCCGG - Intronic
993922275 5:93820254-93820276 GGTGTGCTGAGATCAATAACTGG + Intronic
995558200 5:113352567-113352589 GCTGTAAAGAGCTCACCATCTGG + Intronic
995887626 5:116913943-116913965 TGTGTGTTGACCTAAACATCAGG + Intergenic
998919516 5:147052508-147052530 GCTGTGATCAGCTGAGCATCAGG + Intronic
1003151525 6:3555530-3555552 TGTCTGATAATCTCAACATCTGG + Intergenic
1003201299 6:3963721-3963743 GGTGTGAAGAGATGAAGATCTGG + Intergenic
1007385805 6:41519562-41519584 GGTGGGGTGAGCTGAGCATCTGG - Intergenic
1014499415 6:122166481-122166503 GGTGTGGTGCACTCAACATATGG + Intergenic
1016384520 6:143517341-143517363 GCTGTGATGAGCTCAGCCTGAGG - Intergenic
1016635594 6:146286007-146286029 GGTGTGGGAAGCTCAACATTTGG - Intronic
1017537845 6:155367468-155367490 GATGAGATGGGCTCAACATGGGG + Intergenic
1019015509 6:168877080-168877102 GGTGTGATGAGCACAGCATGAGG + Intergenic
1024774791 7:52771368-52771390 TGTGTGATGACGTCAACAACAGG + Intergenic
1032088182 7:128894423-128894445 GGGGTGAGGAGTTCAACATATGG - Intronic
1034876635 7:154730220-154730242 TGTGAGATCAGCTCAATATCTGG + Intronic
1036684195 8:10898286-10898308 GGCGCCATGGGCTCAACATCGGG + Exonic
1045269924 8:100652902-100652924 GGGGTGATGTGCGCAACACCTGG - Intronic
1048874611 8:138827243-138827265 GGTGTGAAGATTTCAACATATGG - Intronic
1052803801 9:32994368-32994390 AGTATGATGAGCTTAACTTCAGG - Intronic
1054847109 9:69809236-69809258 AGTGTAATGAGATCAGCATCTGG - Intergenic
1062221644 9:135419271-135419293 GGTGTGATGAGCTCAGAAGGAGG - Intergenic
1186213783 X:7277959-7277981 GGTGTGATGAGATCAGCGTGAGG - Intronic
1186406789 X:9311592-9311614 GGTGAGATGAGGTCATCAGCAGG - Intergenic
1187714586 X:22090316-22090338 GGTGACATGAGCTCAAAATATGG + Intronic
1188271087 X:28141437-28141459 GGTGTGAGGAGATTAACATTTGG + Intergenic
1192360527 X:70435910-70435932 GGTGTGATAAGCACAGAATCTGG - Intergenic
1195572911 X:106416383-106416405 GATGTTATCATCTCAACATCTGG - Intergenic