ID: 907983880

View in Genome Browser
Species Human (GRCh38)
Location 1:59511358-59511380
Sequence ATTCTATCTTGGGGCTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907983880 Original CRISPR ATTCTATCTTGGGGCTCAAA GGG Intronic
900546710 1:3233463-3233485 AATCTGTCCTGGGGCGCAAAGGG + Intronic
901869617 1:12130302-12130324 TTTTTATTTTGGTGCTCAAATGG + Intronic
905642049 1:39596755-39596777 TTTCTGCCTTGGGTCTCAAAGGG + Intergenic
906926782 1:50126107-50126129 AATTTATTTTGGGGCTCACAGGG + Intronic
907042244 1:51272948-51272970 TTTCCATCATGGGGCTCATAAGG - Exonic
907983880 1:59511358-59511380 ATTCTATCTTGGGGCTCAAAGGG + Intronic
909742927 1:79055162-79055184 CTTCTATTTTGGGGCTCCACCGG + Intergenic
909968388 1:81947906-81947928 AATCTATTTTGGTGATCAAAAGG + Intronic
910323206 1:85973557-85973579 CTTCTGTTCTGGGGCTCAAAAGG + Intronic
913202306 1:116504733-116504755 ATTCTAAACTGGGCCTCAAAAGG - Intergenic
913215042 1:116613105-116613127 ACTTTATGTTGGGGCTCAAGAGG - Intronic
917700063 1:177571440-177571462 AGGCTATCTTGGGGCTCTGAAGG + Intergenic
918210569 1:182347514-182347536 CTTCTATTTTGGGGTTCATAAGG + Intergenic
920389035 1:205587423-205587445 TTTCTTTCTTGGGGGTCAACTGG - Intronic
922590527 1:226772499-226772521 ATTCTATCATGGGGTTCAGTGGG - Intergenic
923953193 1:238984305-238984327 ATTCTATCATGGGCCAAAAATGG + Intergenic
924310660 1:242739566-242739588 AATCTGTATTGGGTCTCAAATGG - Intergenic
1063600027 10:7472821-7472843 ATTCCTTCTTGAGGCTCTAAAGG + Intergenic
1066823426 10:39527647-39527669 TTTCTAACATGGGCCTCAAATGG - Intergenic
1070752026 10:78969509-78969531 ATGCTATATGGGGGCTCAACGGG + Intergenic
1072449968 10:95532093-95532115 TTACTCTCTTGGGGCTAAAAAGG + Intronic
1074475192 10:113767264-113767286 ATTTTATATTGGGATTCAAATGG - Intronic
1075557269 10:123442721-123442743 ACACTATGTTGGGACTCAAAAGG - Intergenic
1075843252 10:125522676-125522698 ATACCATCTAGGGGCTCAAGAGG - Intergenic
1078106718 11:8362446-8362468 ATTCAATCTTGGGGCTGATCGGG + Intergenic
1078664814 11:13315735-13315757 CTGCCATCCTGGGGCTCAAAAGG - Intronic
1079610461 11:22426666-22426688 ATTGTTTCTTGGGGCTCAGGGGG + Intergenic
1083311684 11:61786955-61786977 ATACCATCTGGGGGCTCAAAGGG - Exonic
1091902600 12:4156615-4156637 ATGCTGCCCTGGGGCTCAAAAGG - Intergenic
1093731222 12:22567943-22567965 ATTCTTTTCTGGTGCTCAAAAGG + Intergenic
1095157278 12:38872886-38872908 ATTCAATCTTTGGGTTCAAAAGG + Intronic
1096028113 12:48385994-48386016 ATTTTTTCTTGGGGCACCAATGG - Intergenic
1099043648 12:77687787-77687809 ATTCTATCCTGATCCTCAAATGG - Intergenic
1099496459 12:83352947-83352969 GTTCTATCTAGAGGCTCAACTGG + Intergenic
1101305759 12:103526152-103526174 ATTCTTTCTTGAGGATTAAAGGG - Intergenic
1102524931 12:113505724-113505746 ATTCCATCTCGGGGCTGACAAGG - Intergenic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1105218773 13:18306595-18306617 ACTTTATGTTGGGGCTCAAGAGG - Intergenic
1106920404 13:34557136-34557158 ATTCTATGTTGAGAGTCAAAGGG + Intergenic
1107756645 13:43630594-43630616 ATTCTACATTGAGGCTCACAAGG - Intronic
1108648772 13:52455507-52455529 GTTCTATCTTGGCGCTAAAGCGG + Exonic
1118759637 14:68872213-68872235 ATTCTATCTGGAGGCTCTCAGGG + Intergenic
1121424748 14:93841842-93841864 GTTCCTTCTGGGGGCTCAAAAGG - Intergenic
1121896189 14:97650110-97650132 ATTCTTACTGGGGGCTCCAAGGG - Intergenic
1125322348 15:38501674-38501696 ATTCTATCTTGGTTCTCTATAGG - Intronic
1125746118 15:41998285-41998307 ATTCTTTCTTTGGCCTCAACAGG + Intronic
1129695239 15:77737222-77737244 GTTCTAACTTAGGGCTCACATGG - Intronic
1131068009 15:89446429-89446451 ATCCTATCTTGAGGCTCATCTGG - Intergenic
1134701370 16:16268501-16268523 ATTTTATCTTGGGAACCAAACGG - Intronic
1138073466 16:54017095-54017117 ATTCTATCTTGAGGTTTTAATGG - Intronic
1141634159 16:85304885-85304907 ATTTTTTTTAGGGGCTCAAAAGG - Intergenic
1143583934 17:7842198-7842220 GTTCTCTCTTGGGGCTCCAGCGG + Intronic
1145688942 17:26712859-26712881 ATTCCACCATGGGGCGCAAAGGG - Intergenic
1148065290 17:44864724-44864746 ATTCTATCTTGGGAACCAAAAGG - Intronic
1148227990 17:45912543-45912565 ATTCTCTCTTGGAGCTCCAGAGG + Intronic
1149157716 17:53652733-53652755 AACCTGTCTTAGGGCTCAAAAGG - Intergenic
1152647448 17:81476060-81476082 ATGCTATCCTTGGGCCCAAATGG + Intergenic
1155132609 18:22953495-22953517 ATACTATCTTGGGGATGAAATGG - Intronic
1155637905 18:27976881-27976903 TTCCTATCCTGGGGCTGAAAGGG + Intronic
1156722431 18:40086253-40086275 ATTCCTTCTTGGGTCTCAAAGGG - Intergenic
1158234739 18:55300671-55300693 TTTCTATTTTGTGGCTCATATGG - Intronic
1158888682 18:61853254-61853276 TTTCTTTCTGGGGGCTCTAACGG + Intronic
1161020740 19:2010244-2010266 ATTCTCTCATGGGGCTTGAAGGG - Intronic
925050728 2:813230-813252 ATTCTCTTCTGGGGCTCACATGG + Intergenic
930322478 2:49874023-49874045 ATTCTTTCTTGAGGCTCTAAGGG - Intergenic
931259796 2:60607389-60607411 GTTCCTTCTTGGGCCTCAAAAGG + Intergenic
932478603 2:72024641-72024663 TTTCTCTTTTGGGGCTCATAAGG - Intergenic
938801758 2:134770383-134770405 ATTCTTTCTGGAGGCTCTAAGGG + Intergenic
939020808 2:136956289-136956311 ATTCTCTCTTGGGGCCAAACTGG - Intronic
939282867 2:140087926-140087948 ATTCTATCTTGGAACACAACAGG + Intergenic
940283768 2:152013525-152013547 ATTCCATCATGGGACTCACAAGG - Intronic
940653979 2:156466093-156466115 ATTTTATTTTGGGGCTCTCAGGG + Intronic
942647167 2:178125105-178125127 ATAGTATATTGAGGCTCAAAAGG + Intronic
942874237 2:180774391-180774413 ATTCTGTCTGGGGAATCAAAGGG + Intergenic
943601670 2:189928639-189928661 TTTCCATCATGGGGCTCATAAGG + Intronic
944515499 2:200508934-200508956 ATTCTAACTTGGGGGGCAGAAGG - Intronic
945206687 2:207340440-207340462 ATTCTATTTTAGGGCCCCAAAGG - Intergenic
945252977 2:207779821-207779843 ATGCTATCTGGGGCCTCAGATGG - Intergenic
948133518 2:235619364-235619386 ATTCAATCCTGGGGCTGAAGTGG + Intronic
948133537 2:235619430-235619452 ATTCAATCCTGGGGCTGAAGTGG + Intronic
948133556 2:235619496-235619518 ATTCAATCCTGGGGCTGAAGTGG + Intronic
948421437 2:237862963-237862985 GCTCGATCTAGGGGCTCAAAAGG - Intronic
1171825151 20:29892593-29892615 TTTCCATCATGGGCCTCAAAGGG - Intergenic
1176091584 20:63320760-63320782 ATTCTGTCCTGGGGCTCATGCGG + Intronic
1177405625 21:20663889-20663911 ATTCTCTCTTTAGGCTCATAAGG + Intergenic
1177815775 21:25974908-25974930 ATTCCATCTTGAAGGTCAAAGGG - Intronic
1179602123 21:42486342-42486364 TTTCTATCTTGGGTCTTAACGGG - Intronic
1182011138 22:27001632-27001654 AATTTATGTTGGGGCTCAGAAGG + Intergenic
1184832991 22:47002322-47002344 ATTCTATCTTGGGGACAAACAGG - Intronic
951965491 3:28379859-28379881 TTTCTGTTTTGGGGGTCAAAGGG + Intronic
952859886 3:37804182-37804204 ATCCTATGTTAGGGCTCTAAGGG - Intronic
954111449 3:48435718-48435740 TTTCTGTCTTGGGTCACAAATGG - Intronic
955373169 3:58371198-58371220 ATTCTATCTGAAGACTCAAATGG - Intronic
956132697 3:66069373-66069395 ATTCCTTCTGGGGGCTCTAAGGG + Intergenic
958214585 3:90546175-90546197 TTTCTACCTTAGGCCTCAAATGG + Intergenic
958215762 3:90572463-90572485 TTTCTACCTTAGGCCTCAAAGGG + Intergenic
958219415 3:90645198-90645220 TTTCTATCATAGGCCTCAAAGGG + Intergenic
958219700 3:90650962-90650984 TTTCTAGCTTAGGCCTCAAACGG + Intergenic
958221273 3:90684677-90684699 TTTCTACCTTAGGCCTCAAACGG + Intergenic
958223195 3:90773593-90773615 TTTCTATCATAGGCCTCAAACGG - Intergenic
958225057 3:90805027-90805049 TTTCTACCTTAGGCCTCAAACGG - Intergenic
958225970 3:90820317-90820339 TTTCTATCATAGGCCTCAAACGG - Intergenic
958226069 3:90822016-90822038 TTTCTACCTTAGGCCTCAAACGG - Intergenic
958227286 3:90842409-90842431 TTTCTACCTTAGGCCTCAAACGG - Intergenic
958228631 3:90865343-90865365 TTTCTACCTTAGGCCTCAAACGG - Intergenic
958230342 3:90894229-90894251 TTTCTATCATAGGCCTCAAACGG - Intergenic
958230847 3:90902724-90902746 TTTCTACCTTAGGCCTCAAACGG - Intergenic
958243235 3:91110858-91110880 TTTCTACCTTAGGCCTCAAACGG - Intergenic
958245374 3:91146542-91146564 TTTCTATCATAGGCCTCAAACGG - Intergenic
958248624 3:91200912-91200934 TTTCTACCTTAGGCCTCAAACGG - Intergenic
958564480 3:95791235-95791257 ATTCTATCTGAGCCCTCAAAGGG + Intergenic
959193002 3:103139568-103139590 AAGCTATCTTGGGCCACAAATGG + Intergenic
961961181 3:130856958-130856980 ATTGTAACTTTGGGCACAAATGG + Intronic
965179318 3:165381666-165381688 ATTCTCTCTGGAGGCTCAAGGGG + Intergenic
966126684 3:176585726-176585748 ATTCTGTCTTGTGGATGAAATGG - Intergenic
966322382 3:178715424-178715446 ATTCCTTCTGTGGGCTCAAATGG + Intronic
968270320 3:197398593-197398615 TTGCTTTCTTGGGGCTCAAATGG - Intergenic
969634906 4:8362729-8362751 AAGCTATCTTGAGGCTCAAGAGG + Intergenic
970224593 4:13844467-13844489 ATGCTCTCCTGGGGCTGAAAAGG + Intergenic
970629144 4:17922534-17922556 ATTCTATCTCCCGGCTCAAGAGG + Intronic
971269397 4:25126429-25126451 ATTATATATTGGTGTTCAAATGG + Intronic
972175132 4:36394828-36394850 TTTCTATCTTCAGGCTCACATGG + Intergenic
975226863 4:71882818-71882840 ACTCTCTCTTGGGGCTCGACTGG + Intergenic
975315827 4:72952284-72952306 CTACTAACTTGGGTCTCAAAAGG + Intergenic
982110252 4:152046849-152046871 ATTCTGTCTTGGGGTTCTGATGG - Intergenic
983069533 4:163252717-163252739 TTTTTTTCTTGGGGCTCAGAGGG + Intergenic
983710567 4:170710588-170710610 ATTCAATCTTGGGGTCAAAATGG - Intergenic
985106712 4:186506804-186506826 ATTCTCACTTGAGGCGCAAATGG + Intronic
988274287 5:29060387-29060409 AATCTGTCTTTGGACTCAAATGG - Intergenic
990228107 5:53679632-53679654 ATTCTACCTGGCGGCTGAAAGGG + Intronic
990700888 5:58473958-58473980 CTTTGTTCTTGGGGCTCAAATGG - Intergenic
992805579 5:80334098-80334120 ATTTTAGCTTGGGGGTCAGATGG - Intergenic
993169168 5:84394871-84394893 ATCCTTTTTTGGGTCTCAAATGG + Intergenic
993382654 5:87225261-87225283 ATTCTTTCTGGAGGCTGAAAGGG - Intergenic
995856696 5:116600346-116600368 ATTCTTTCTGGGGGCTCTAGGGG + Intergenic
997055522 5:130438767-130438789 ATTCTGTCTTGGGCCAGAAATGG - Intergenic
997642363 5:135457681-135457703 ATCCTCTCTTGGGGCCCAAGAGG + Intergenic
997806634 5:136924437-136924459 TTTCTACCTTGGGGTTGAAAAGG - Intergenic
998213290 5:140217954-140217976 AGTTTATCTTGGAGGTCAAAAGG + Intronic
999586844 5:153098997-153099019 ATTCCATTTTGGTGCTCAATAGG + Intergenic
1007192745 6:40033432-40033454 AATCTATAATAGGGCTCAAAAGG + Intergenic
1011384260 6:86777685-86777707 ATTCTATGTTTGTGTTCAAAAGG - Intergenic
1014645567 6:123968351-123968373 ATTCCATCTTGGGGCTGAAGAGG + Intronic
1020520374 7:9178344-9178366 ATTCTATCTGGAGGCTTTAAGGG - Intergenic
1022614469 7:31915102-31915124 ATTCTATCCTGGGTAGCAAATGG - Intronic
1027912416 7:84268337-84268359 ATCCTACCTTGGGACTCCAAAGG - Intronic
1028478517 7:91277971-91277993 TTTCTTTCTGGGGGCTCTAAGGG + Intergenic
1030232169 7:107220329-107220351 ATTCTATCTTTGGGTCAAAATGG + Intronic
1032495213 7:132356224-132356246 TTTCTATCCAGGTGCTCAAATGG + Intronic
1032514321 7:132495535-132495557 CTTCCATCCTGGGGCTCAGATGG - Intronic
1034207081 7:149326916-149326938 ATGCTCTCCTGGGGCTCAACTGG - Intergenic
1038493383 8:27985500-27985522 ATTCTAACTTGGGGTTGAAAAGG + Intronic
1040863289 8:52022835-52022857 CTTCTCTCATGGGGCTCACAAGG - Intergenic
1041710293 8:60888231-60888253 ATCCAATCTTAAGGCTCAAATGG + Intergenic
1042888395 8:73578553-73578575 ATTCTACCTGCAGGCTCAAATGG + Intronic
1043389157 8:79775044-79775066 ATTCCAGTTTGGGGCTCACATGG - Intergenic
1043629730 8:82314838-82314860 ATTTTATCTGGGGCATCAAAAGG - Intergenic
1044852182 8:96439846-96439868 ATTTAATCTAGGGGCTCAAAAGG + Intergenic
1047993289 8:130309219-130309241 ATTCAGTCTTGGGAGTCAAATGG + Intronic
1049079549 8:140431047-140431069 AGTATATGTTGGGGCTTAAAGGG - Intronic
1053229662 9:36396866-36396888 ATTTTGTCTTGGATCTCAAAGGG - Intronic
1055623304 9:78147993-78148015 ATTCTATGCTTGGGCTGAAATGG + Intergenic
1055642183 9:78328055-78328077 CTTCTATTTTGGGGCTCCACTGG - Exonic
1055665865 9:78552318-78552340 ATATTTTCTTGGGGCCCAAAGGG + Intergenic
1058025547 9:100139350-100139372 CTTTTATCTTGGGGCAGAAATGG - Intronic
1058324380 9:103677436-103677458 ATTCCTTCTTGGGGCACCAAGGG + Intergenic
1058938330 9:109790097-109790119 CTTTTATCTTGGGCCTCACATGG - Intronic
1059709998 9:116858943-116858965 AGTCTAACTTGGGTCTCAATGGG + Intronic
1203373153 Un_KI270442v1:332528-332550 TTTCCACCATGGGGCTCAAAGGG - Intergenic
1203402775 Un_KI270519v1:129528-129550 ATTCCACCTTAGGCCTCAAAGGG + Intergenic
1189047641 X:37610558-37610580 ATTCTATCTACGGGCACAGAGGG - Intronic
1190777040 X:53561240-53561262 ATTCTAACTTGACGCTAAAAGGG + Intronic
1193222822 X:78946788-78946810 AGTTTATTTTGGGGCTCAACTGG + Intronic
1193773032 X:85610131-85610153 ATTCTATCTGGACTCTCAAAGGG + Intergenic
1195716597 X:107825035-107825057 TTTCTAACTTGGGGCAAAAAGGG - Intergenic