ID: 907984494

View in Genome Browser
Species Human (GRCh38)
Location 1:59517197-59517219
Sequence CAGGTTGTTATTGCCTTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907984494_907984496 -9 Left 907984494 1:59517197-59517219 CCCTGAAAGGCAATAACAACCTG No data
Right 907984496 1:59517211-59517233 AACAACCTGATTTCTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907984494 Original CRISPR CAGGTTGTTATTGCCTTTCA GGG (reversed) Intronic
No off target data available for this crispr