ID: 907985441

View in Genome Browser
Species Human (GRCh38)
Location 1:59525104-59525126
Sequence CTGGATCTGATGTGCTGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907985441_907985443 -7 Left 907985441 1:59525104-59525126 CCCATGCAGCACATCAGATCCAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 907985443 1:59525120-59525142 GATCCAGCTGCAGCCTTGCGTGG 0: 1
1: 1
2: 27
3: 76
4: 267
907985441_907985445 -1 Left 907985441 1:59525104-59525126 CCCATGCAGCACATCAGATCCAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 907985445 1:59525126-59525148 GCTGCAGCCTTGCGTGGAGCTGG 0: 1
1: 10
2: 29
3: 100
4: 875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907985441 Original CRISPR CTGGATCTGATGTGCTGCAT GGG (reversed) Intronic
903868262 1:26413499-26413521 CTGGGTCAGATGTGCTGGCTTGG + Intronic
904157681 1:28498216-28498238 CTGGGTGTGGGGTGCTGCATAGG + Exonic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
907156520 1:52339984-52340006 CTTGCTATGATGTGCTGCACAGG + Intronic
907985441 1:59525104-59525126 CTGGATCTGATGTGCTGCATGGG - Intronic
915329013 1:155097814-155097836 CTGATTCTGGTGTGCTCCATGGG - Intergenic
916242576 1:162654781-162654803 CTGGATTCAATGTGCTGCAATGG - Intronic
920308751 1:205035649-205035671 CTGGATCTGATTTGCATCTTTGG + Intergenic
920761998 1:208793227-208793249 CCTGATCTGCTTTGCTGCATTGG + Intergenic
921025152 1:211271841-211271863 CTATATCTGATGTGCCGCAAAGG - Intronic
922636765 1:227181098-227181120 CTGTTTTTGATTTGCTGCATAGG - Intronic
1063310603 10:4948565-4948587 CTACATCTGATGTACTGAATTGG + Intronic
1067509674 10:46884553-46884575 CTGTACCTGCTGTGCTGCATGGG + Intergenic
1067652580 10:48167305-48167327 CTGTACCTGCTGTGCTGCATGGG - Intronic
1069871493 10:71535836-71535858 CCGGCCCAGATGTGCTGCATAGG + Intronic
1076934744 10:133559820-133559842 CTGGATCTAATGGACTGCAGTGG + Intronic
1077532531 11:3103915-3103937 CTGGATGGGATGGGCTGCAGAGG - Intronic
1081590547 11:44419872-44419894 CTGGATCTGATGTGATGCCATGG + Intergenic
1085491240 11:76920082-76920104 CTGGTTCTGGTGTGCTGGCTTGG + Intronic
1087963557 11:104383227-104383249 CTGTATCTGTGGTTCTGCATTGG + Intergenic
1090227948 11:125082825-125082847 CTGGATCTGCTGGGCTGCACTGG + Intronic
1091179211 11:133588406-133588428 CTGGATCTCATGACCTGTATAGG - Intergenic
1091323707 11:134668913-134668935 GGGGATCTGATGTGCTGCCTGGG + Intergenic
1094871031 12:34599422-34599444 GTGGGTCTGAGGTGCTTCATGGG - Intergenic
1095264519 12:40138454-40138476 CTGGAGCTGAGGCACTGCATGGG + Intergenic
1099582886 12:84475514-84475536 CTGCTTTTGATGTGCTACATAGG - Intergenic
1100172969 12:91998120-91998142 CTGGTTTTGCTGTGTTGCATAGG - Intronic
1102363892 12:112314456-112314478 CTGTAGCTGATGTGCTATATAGG - Exonic
1102950433 12:117027398-117027420 CTGAATGAGATGTGCTGCACCGG - Exonic
1103290392 12:119841036-119841058 CTGGATCTGATGCCCTGCTTGGG - Intronic
1104714958 12:131010628-131010650 TTGGCTCAGATGTGCTGCGTGGG + Intronic
1107410504 13:40153626-40153648 CTGGTGCTGATGTCCTGAATAGG - Intergenic
1109013528 13:56979534-56979556 CTGAATCTGCTGTGCTTCTTGGG + Intergenic
1109441582 13:62380912-62380934 CTGAATCTGATCCACTGCATTGG + Intergenic
1109567088 13:64131712-64131734 CTGGACCTGCTGTGCTCCAGAGG + Intergenic
1110287378 13:73765538-73765560 CTGGAAGTGATGTGCTACACTGG + Intronic
1110484915 13:76027474-76027496 CTGTATCTGATCTGCTGAAATGG + Intergenic
1112175684 13:97021300-97021322 CTGGATCTGATGTGTTCCCATGG + Intergenic
1115912663 14:38273647-38273669 ATTGATCTGATGTACTGCTTTGG + Intergenic
1116653232 14:47620957-47620979 CTGGATCTAATTTTCAGCATTGG - Intronic
1119880891 14:78098644-78098666 AAGGATCTGAAGTGGTGCATAGG + Intergenic
1121674332 14:95740265-95740287 CTGGATCTGATGAGTTGGAGGGG + Intergenic
1125147593 15:36490321-36490343 CTGGAGGTGATGTGCTGCCGTGG - Intergenic
1125815194 15:42577887-42577909 TTGGATCTGATGTTGTGCTTGGG + Intronic
1129444480 15:75607238-75607260 CTGGATGTGATGTGCTGGCGGGG - Exonic
1141615481 16:85207328-85207350 CCGGCTCTGCTGTGCTGCACTGG + Intergenic
1144591497 17:16527950-16527972 CTGGATCTCAGGTGCAGCAAGGG + Intergenic
1147847439 17:43414434-43414456 CTGGGACTGGTATGCTGCATTGG - Intergenic
1152766897 17:82146393-82146415 CTGGATCTCCTGTGCTGCCCAGG + Intronic
1156994398 18:43448263-43448285 CTGGGTGTGATGTGCAGCTTGGG + Intergenic
1158337105 18:56424733-56424755 CTGGAAATGATGTGGTGGATGGG - Intergenic
1161462954 19:4409706-4409728 CTGGTACTGCTGTGCTGCTTTGG - Exonic
1162309700 19:9898745-9898767 ATGGATCAGATGTGATGAATTGG - Intronic
925939956 2:8807722-8807744 CTGGCTCCCATGTGCTGTATTGG - Intronic
927234113 2:20854413-20854435 CTGAAACTGATCTGCTTCATAGG - Intergenic
928727485 2:34191638-34191660 CTTGGGCTGATGTCCTGCATGGG + Intergenic
929969064 2:46558089-46558111 CTTGATATGACTTGCTGCATGGG - Intronic
931344534 2:61433864-61433886 ATGGAGCTGAAGTGCTGCAGAGG - Intronic
931572285 2:63681280-63681302 CTGGATCTGCTGTGGAGCAGAGG + Intronic
931631132 2:64300724-64300746 CTGGTTCTGATGTGCAGCCAAGG + Intergenic
936245945 2:110827435-110827457 CTGGGTCTGATGTGGTGCGCTGG + Intronic
938082454 2:128377425-128377447 CTTGAGCAGATGGGCTGCATAGG - Intergenic
939437044 2:142190893-142190915 CTAGAGCTGATGTCTTGCATTGG - Intergenic
939522810 2:143253029-143253051 CTTCAGCTGATGTGCTACATTGG + Intronic
946456761 2:219832797-219832819 CTGGTTCTGATGAGCTGAAACGG - Intergenic
1169531327 20:6488361-6488383 CTGGATCTGAGGAGGTGCAATGG + Intergenic
1172012079 20:31851420-31851442 CTGGACCCGATGGGGTGCATGGG + Intronic
1172185148 20:33026980-33027002 CTGCATCTGAGCTGCTGCGTTGG - Intergenic
1172818031 20:37705143-37705165 CTGGGTCAGATGGCCTGCATTGG + Intronic
1172840890 20:37902354-37902376 CTGGACCTTATGTGGTGGATGGG - Intergenic
1174572132 20:51509318-51509340 GTGGAGCTGATGTGCTGGCTAGG - Intronic
1177202058 21:17968431-17968453 CTGGAACTGATGTGCTTGTTTGG + Intronic
1178895164 21:36551598-36551620 CTGGATCTGAGATGCCGCCTTGG + Intronic
1185230445 22:49677468-49677490 CTGGCTCTCATGTTCTCCATGGG - Intergenic
951571690 3:24070646-24070668 CTGCATCTGTTTTGCTGCAAGGG + Intergenic
953243570 3:41170588-41170610 TTGCATTTGATGTGCTCCATGGG + Intergenic
954894880 3:53966611-53966633 CTGGCTCTGATGTGCGTGATTGG + Intergenic
956981055 3:74638133-74638155 CAGGATATGATGTGCTGATTTGG - Intergenic
962498998 3:135970105-135970127 CTTGATCTGATTTGCTGCCTTGG + Intronic
969250687 4:5966580-5966602 CTGGATCTGATCTGCAACTTAGG - Intronic
969892406 4:10271949-10271971 TTGGTTCTGATGTGCTGTATTGG + Intergenic
971409280 4:26353271-26353293 CTTGCTGTGATCTGCTGCATAGG - Intronic
971464350 4:26939456-26939478 CTGGATCTAAAGGGCTGAATCGG + Intronic
972634904 4:40875063-40875085 CTGGCTCAGCTGTGCTGCCTGGG + Intronic
974603567 4:64120983-64121005 CTGGATATGATATTCTGGATTGG + Intergenic
976217971 4:82732528-82732550 CAGGATCTGATGTGATGGGTAGG - Intronic
980045038 4:127978433-127978455 CTGGATGTGATGAGATGGATTGG + Intronic
982383752 4:154778022-154778044 CAGGTTCTGATTTGCTGCCTTGG + Intergenic
984344309 4:178502823-178502845 CTCCATCTGAATTGCTGCATCGG + Intergenic
984595851 4:181667288-181667310 CTGGAAGTGATGTGCAGGATGGG - Intergenic
990516207 5:56533142-56533164 CTGGATCTGGAGTTCTGCATGGG + Exonic
991561269 5:67956057-67956079 ATGGGTCTGGGGTGCTGCATGGG - Intergenic
992260715 5:74967565-74967587 CTTTCTCAGATGTGCTGCATTGG + Intergenic
997039396 5:130233954-130233976 CTGGAACAGATGTGCAGCACTGG + Intergenic
997725721 5:136118377-136118399 CAGGATCCGTTGTGCTGCCTGGG + Intergenic
998875382 5:146593854-146593876 CTGAATCTGCTGTGTTGCAATGG + Intronic
1001259100 5:170211680-170211702 CTGGACCTGCTGTGGGGCATGGG - Intergenic
1003317311 6:5024378-5024400 CTGGCTCTGATTGGCAGCATAGG + Intergenic
1005779027 6:29168950-29168972 CTGGCTCTGATGGGCTCCAGTGG + Intergenic
1006367191 6:33622489-33622511 CTGGATGTGATTCGCTGGATGGG + Intronic
1008911823 6:56742270-56742292 GTGGGACTGATGTGCTGTATGGG - Intronic
1010958251 6:82116126-82116148 CTGACTGTGATGTTCTGCATGGG - Intergenic
1016410569 6:143778913-143778935 GTTGATCTTAAGTGCTGCATTGG + Intronic
1018398056 6:163395959-163395981 CAGGGTCTGATGGGCTGCTTGGG + Intergenic
1021710112 7:23407694-23407716 CTGGAAGTGATTTGCTGAATTGG - Intronic
1021746337 7:23745076-23745098 CTGGCTGTGATGTGCTGAGTGGG + Intronic
1022467548 7:30661810-30661832 CTGGATGTCATGTGCGGCCTTGG + Intronic
1024497702 7:50067239-50067261 GTGGTTGTGATGTGCTGCAAGGG - Intronic
1026943618 7:74302794-74302816 CTGGATCTGCTGTGATGCTGGGG + Intronic
1029957109 7:104651749-104651771 CACGCTCTGATGTGCTTCATGGG - Intronic
1030932440 7:115541614-115541636 CTGGTTCTGATGTGAGGCACTGG + Intergenic
1032476752 7:132216526-132216548 CTGGCTCTGATAGGCAGCATGGG + Intronic
1032946350 7:136857502-136857524 CTGCATGTGAAGTGCAGCATTGG + Intergenic
1035318198 7:158010848-158010870 CAGCATCTGAGGTGCTCCATGGG - Intronic
1036809687 8:11859057-11859079 CTTGGTCTGCTGTGCTGCTTAGG + Intronic
1042633356 8:70844877-70844899 CTGGATAGGATGTGGAGCATGGG - Intergenic
1043566784 8:81558027-81558049 CTGGCTCTGCTGTGCTCCAGTGG - Intergenic
1045842187 8:106593410-106593432 CTAGATGTGATGTGCTGTTTCGG - Intronic
1048857743 8:138698474-138698496 CCGGAGCTGAGCTGCTGCATGGG + Intronic
1050034552 9:1421663-1421685 CTGGCTCTGATGTGTCACATTGG - Intergenic
1054805294 9:69391610-69391632 CTGGATGTGCTGGGCTGCAATGG - Exonic
1055056047 9:72025143-72025165 CTTGATCTGAAGAGCTGCAGGGG + Intergenic
1061134557 9:128725880-128725902 CAGGATCTGATGTGCTCAGTGGG + Intergenic
1186073569 X:5851207-5851229 CTTGATTTGATGACCTGCATGGG + Intronic
1186388990 X:9139239-9139261 CTGGATCTGATGTGATGGGAAGG + Intronic
1188170080 X:26912950-26912972 CTGTGTCTGATGTGCTACCTAGG - Intergenic
1189952233 X:46244747-46244769 CTGGATCTGGTGTGCTAGAGGGG + Intergenic
1190263594 X:48814862-48814884 CTGGATTTGATGCCCTGCAAGGG + Exonic
1196555809 X:117083651-117083673 GTGGATGTGGTGTGCTGCACTGG + Intergenic
1198783819 X:140265936-140265958 CTGGACCTGCTGTACTGCTTAGG + Intergenic
1199778070 X:151033199-151033221 CAGAATGTGATGTGCTGCTTTGG - Intergenic
1199865691 X:151848141-151848163 CTGGATCTGCAGTGCTGCTCTGG + Intergenic