ID: 907987460

View in Genome Browser
Species Human (GRCh38)
Location 1:59546402-59546424
Sequence CTTGCTCTGCAGAGGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 383}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907987453_907987460 -10 Left 907987453 1:59546389-59546411 CCTTCCCTATTATCTTGCTCTGC 0: 1
1: 0
2: 1
3: 25
4: 236
Right 907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG 0: 1
1: 0
2: 0
3: 34
4: 383

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907987460 Original CRISPR CTTGCTCTGCAGAGGGTGGG AGG Intronic
900339796 1:2182589-2182611 CTTGGTCTGCAGGGGCTGGGGGG + Intronic
900494527 1:2970496-2970518 CCTTCTCTGCAGTGGCTGGGCGG + Intergenic
900900791 1:5514247-5514269 CCTGCTCTGCAGAGAATGGATGG - Intergenic
901156687 1:7144958-7144980 CAAGCTCTGCAGCGGTTGGGAGG + Intronic
901322803 1:8349724-8349746 CTTGCTCTGCAGATATTGGAGGG - Intergenic
901704179 1:11060806-11060828 CTTGCTCTTTGAAGGGTGGGTGG + Intergenic
901870951 1:12138977-12138999 CTGCTTCTGCAGAGGGTGGGTGG - Intronic
902667313 1:17948657-17948679 CATGCTCGGGAGAGGGTGGCGGG - Intergenic
903349970 1:22711380-22711402 CTTGCTCCGCACAGGGTGGAGGG + Intronic
904373275 1:30064388-30064410 ATTTCTCTGCAGTGTGTGGGTGG + Intergenic
905207123 1:36349328-36349350 CTTCCTCTGCAGTGGTTGTGGGG - Intronic
905210474 1:36370561-36370583 GGTGGTCTGCAGAGCGTGGGTGG - Intronic
905314407 1:37072597-37072619 CTGGCTGGGCAGAGGGTTGGGGG - Intergenic
905408778 1:37754175-37754197 GCTGCACTGCGGAGGGTGGGGGG - Intronic
905627541 1:39498679-39498701 CTTGGCCTGCAGAGGCTGTGGGG + Intronic
905668883 1:39778429-39778451 CTTGGCCTGCAGAGGCTGTGGGG - Intronic
905820033 1:40981857-40981879 CTTGCTCTGGGGAGGGGGTGGGG + Intronic
905898225 1:41562942-41562964 CTTTCTCTGGGGTGGGTGGGGGG - Intronic
905996411 1:42385094-42385116 CTGGTTCTTCAGAGGGAGGGGGG - Intronic
906147594 1:43569225-43569247 CTGGGGCTGCAGGGGGTGGGGGG - Intronic
906567947 1:46813890-46813912 CCTGCTAAGCAGAGGGTAGGAGG - Exonic
907120700 1:52005652-52005674 CTTGCTCTGGAGGGAGGGGGTGG - Intergenic
907438339 1:54463570-54463592 TTTGCTCAGGAGAGGGAGGGAGG - Intergenic
907454428 1:54566057-54566079 CTGGCTCTCCAGAGGGAAGGGGG - Intronic
907790691 1:57660613-57660635 CTCACTCTGCTGAGGCTGGGAGG + Intronic
907987460 1:59546402-59546424 CTTGCTCTGCAGAGGGTGGGAGG + Intronic
909593831 1:77381981-77382003 CTCCCTGTGCAGAGGGTGGGTGG - Intronic
911664267 1:100536288-100536310 CTTGCTATTCAGAGGGTTGAAGG - Intergenic
911950732 1:104170866-104170888 CTTTCTTTGAAGAGAGTGGGTGG + Intergenic
913180057 1:116312316-116312338 CTTGTTCAGGAGAGGTTGGGAGG + Intergenic
913181952 1:116330737-116330759 TGAGCTCTGGAGAGGGTGGGAGG + Intergenic
913283671 1:117208853-117208875 CTGGGTCTGCAGAGGATGGCAGG + Intronic
916144826 1:161728870-161728892 CTAGCTCTGCAGAGGATTGATGG - Intergenic
916213500 1:162376825-162376847 CCTGCTCTGGAGAGGCTGGCTGG + Exonic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
916997456 1:170316054-170316076 GTTTCTCTACAGAGGGTGGCTGG - Intergenic
918151037 1:181798479-181798501 GTTGCTCTCCAGAGCTTGGGAGG - Exonic
919667071 1:200302398-200302420 CCTGCTCTGCCGGGGGTGCGGGG - Intergenic
919923812 1:202181872-202181894 CCTGCCCTGCAAAGGGTGAGGGG - Intergenic
919990203 1:202704112-202704134 GTTTCTCTGCAGGGGATGGGAGG + Intronic
921842958 1:219847608-219847630 CCTGCTCTGCTGTGGGTGGTAGG - Intronic
923070547 1:230560601-230560623 CATGCTCTGCAGAAGGGGGTAGG - Intergenic
923211791 1:231810196-231810218 CTGGCTCTGTACTGGGTGGGTGG + Intronic
1062813651 10:483657-483679 CTTGCTCCTGAGAGGGTGCGAGG + Intronic
1063366831 10:5495948-5495970 CTTGCTCTGGAGCAGGCGGGAGG - Intergenic
1063442161 10:6081543-6081565 CATGAGCTGCAGAGAGTGGGAGG + Intergenic
1063607317 10:7534072-7534094 CCTGTGCTGTAGAGGGTGGGAGG - Intergenic
1064317340 10:14270495-14270517 GGCTCTCTGCAGAGGGTGGGAGG - Intronic
1065289472 10:24215275-24215297 TGGGCTCTGCAGAGGCTGGGAGG + Intronic
1066353039 10:34655018-34655040 CGTGCTCAGCAAATGGTGGGTGG - Intronic
1068710796 10:60131727-60131749 GTTGATGTGCAGAAGGTGGGTGG + Intronic
1069823706 10:71242644-71242666 CTGTCCCTGCAGAGGGTTGGCGG + Intronic
1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG + Intronic
1071368727 10:84928345-84928367 CTGGCTGTCCAGAGTGTGGGAGG + Intergenic
1071979550 10:90989569-90989591 GTTGCTCTGCAGAGGGGAGGAGG - Intergenic
1072537404 10:96373922-96373944 CTGGCTGTGCAGGGGGTGTGTGG + Intronic
1074079752 10:110158147-110158169 GTCTCTCTGGAGAGGGTGGGTGG + Intergenic
1074188593 10:111116886-111116908 CTCGATGTGCAGAGGGAGGGAGG - Intergenic
1075020505 10:118948718-118948740 CTGGATTTGCAGAGGGAGGGAGG - Intergenic
1075690203 10:124389211-124389233 ATTGCTCTGCAGCGCGCGGGGGG + Intergenic
1075715155 10:124551444-124551466 CCTGCTCTGCAGGGTGGGGGCGG + Intronic
1075806306 10:125191332-125191354 CTTGCTGTGCAGATGGAAGGAGG + Intergenic
1075845812 10:125544388-125544410 CTGACTCTGGAGAGTGTGGGGGG + Intergenic
1075851649 10:125593087-125593109 CATGCTCCACTGAGGGTGGGAGG + Intronic
1076705110 10:132297218-132297240 CATGTCCTGCAGAGGGTGTGGGG - Intronic
1076988082 11:253723-253745 CGAGGTCTGGAGAGGGTGGGTGG - Intergenic
1077254186 11:1573115-1573137 CTCGCGCTGCAGGGGGAGGGCGG + Intergenic
1077391127 11:2301092-2301114 CTCCCTCCGCAGAGGGAGGGAGG + Intronic
1077465741 11:2732916-2732938 CTGGGCCTCCAGAGGGTGGGTGG - Intronic
1077533049 11:3106210-3106232 CTTGCTCTGCACAGGGACAGAGG - Intronic
1078107602 11:8368439-8368461 CTGGGTCTGCTGAGGGTGAGGGG - Intergenic
1081575740 11:44317642-44317664 CTGGCTCTGGAGAGTGGGGGAGG + Intergenic
1083777793 11:64902675-64902697 CTGGCTCTGCAGGGGCGGGGTGG + Exonic
1084220370 11:67674250-67674272 CTTGCTCAGGAGAGGGAGGTGGG - Intronic
1084735287 11:71101539-71101561 CTCCATCTGCAGAGGGTGAGAGG - Intronic
1085122138 11:73974095-73974117 CTGACTCCACAGAGGGTGGGTGG - Intergenic
1085258172 11:75188923-75188945 CAGGCTCAGCAGTGGGTGGGAGG - Intronic
1088364680 11:109027989-109028011 CTAGCACTTCAGAAGGTGGGAGG + Intergenic
1088501167 11:110484599-110484621 ATTGAAATGCAGAGGGTGGGAGG - Intergenic
1088737533 11:112740119-112740141 CCTGCTCTGGAGATGGAGGGAGG + Intergenic
1089111557 11:116061761-116061783 CTCCCTCTGGAGAGGGTTGGAGG + Intergenic
1090901207 11:131033381-131033403 GATGCTCTGCAGAGGGAGGCAGG - Intergenic
1092074424 12:5661498-5661520 CTTACTGTGCTGGGGGTGGGTGG + Intronic
1092148128 12:6228841-6228863 GTTGCTCTGCAGACAGTTGGTGG - Intronic
1093675388 12:21933213-21933235 TTTGCTTTTCAGAGGGTGGAGGG + Intronic
1095895689 12:47278175-47278197 CTGGCACTGCATAGAGTGGGAGG + Intergenic
1096622591 12:52874024-52874046 GTGGCTCTGCGGGGGGTGGGAGG - Intergenic
1096751093 12:53759276-53759298 CCTGCTGGGTAGAGGGTGGGAGG - Intergenic
1096814894 12:54195845-54195867 CCTGCTCAGCTCAGGGTGGGAGG - Intergenic
1096867364 12:54572720-54572742 CTTGCTCCGCACAGGGATGGTGG + Exonic
1097178168 12:57155562-57155584 CATGCTCTGTAGAGGATGAGTGG + Intronic
1098819313 12:75208578-75208600 CGGGCTCTTCACAGGGTGGGGGG - Intronic
1099908903 12:88805907-88805929 CTTGCTCTACAGAGGCAGGCTGG - Intergenic
1100136132 12:91555852-91555874 GCTGCTCTGCAAAAGGTGGGAGG + Intergenic
1100717850 12:97324653-97324675 CGTCCTCTGCACAGGGAGGGAGG + Intergenic
1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG + Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102668776 12:114599643-114599665 TTGGCACTGCAGAGAGTGGGGGG + Intergenic
1103300320 12:119921308-119921330 TTTTCTCTGCATAGGGTGGAAGG - Intergenic
1104211416 12:126692218-126692240 CTGGGTCTTCAGATGGTGGGGGG - Intergenic
1104914557 12:132257998-132258020 CTAGCTCAGCAGGGGGTGGCAGG - Intronic
1105442177 13:20424697-20424719 CGGGCTCTGCAGGGGGTTGGGGG - Intronic
1107011579 13:35675860-35675882 CATGCTCACCAGATGGTGGGAGG - Intergenic
1108011830 13:46023175-46023197 ATTGTTCTGCATAGGGTAGGAGG - Intronic
1108352040 13:49596618-49596640 CTTGTCGAGCAGAGGGTGGGGGG + Intergenic
1108925109 13:55732735-55732757 TATACTCTGCAGTGGGTGGGGGG + Intergenic
1109491373 13:63104865-63104887 CTGGCTCTGAAGATGGTGGAAGG - Intergenic
1110262571 13:73502025-73502047 CTAGCTCTGCTGTGGGAGGGGGG - Intergenic
1110642793 13:77845288-77845310 CTTGCTCTGCAGTGGTGGGGAGG - Intergenic
1111271794 13:85896172-85896194 CTTGCTCTGGAGAGGGTTATAGG + Intergenic
1111718276 13:91909231-91909253 CCAGCTCAGCAGAGGCTGGGAGG - Intronic
1112319372 13:98393286-98393308 CTTGCTATTCAGAGCATGGGAGG + Intronic
1113759373 13:112836995-112837017 CGTGACCTGCTGAGGGTGGGGGG - Intronic
1113881075 13:113626634-113626656 CTTGCTCTGCAGAAGTTTTGTGG + Intronic
1115430315 14:33309898-33309920 CTGGCCCTGCAGAGGGAGGAGGG + Intronic
1115754937 14:36520449-36520471 TTTGCTCGGCCGGGGGTGGGGGG - Intronic
1115941626 14:38617190-38617212 CTTGCTCTGCAGCAGGTGAAGGG + Intergenic
1118261966 14:64256078-64256100 CTGACTCTGCATAGCGTGGGAGG - Intronic
1118734290 14:68690867-68690889 CATGCCTTTCAGAGGGTGGGGGG - Intronic
1118919613 14:70138120-70138142 CTTGGTCTTGAGTGGGTGGGTGG + Intronic
1119264495 14:73256001-73256023 CTAGCTAAGCAGAGGGTGGAAGG + Intronic
1119543250 14:75454287-75454309 CCTGCTCTTCAAGGGGTGGGTGG - Intronic
1119940337 14:78633952-78633974 CTTCCCCTGCAGGGGGAGGGAGG - Intronic
1120071054 14:80103116-80103138 CTTGCTTTGCAAAGGAAGGGAGG - Intergenic
1122232623 14:100314283-100314305 CTTGCTGTGCAAACGGAGGGTGG + Intergenic
1122699996 14:103581916-103581938 CCTGCTCTGTGGAGGGAGGGTGG + Intronic
1123018766 14:105387795-105387817 CTGGCTCGGCAGAGGGCAGGTGG + Intronic
1123137049 14:106037817-106037839 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1123206991 14:106723489-106723511 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1123212010 14:106770492-106770514 CCTGTTCTGCAGAGGTGGGGAGG + Intergenic
1123580782 15:21713356-21713378 CTTGCTGAACAGAGGATGGGAGG - Intergenic
1123617431 15:22155979-22156001 CTTGCTGAACAGAGGATGGGAGG - Intergenic
1124723514 15:32133949-32133971 CATGCTCTGCAGATGGTGATTGG + Intronic
1125594154 15:40873737-40873759 CTTGCACTGCAGGGGCGGGGCGG + Exonic
1125968808 15:43895371-43895393 TTTGCTCTGCAGAGGGACAGAGG - Intronic
1126340906 15:47640268-47640290 CTTTCCCTGCAGATGGTGCGAGG - Intronic
1126724627 15:51619836-51619858 CCTGCTCTGGAGAGGGTGTGTGG - Intronic
1127211018 15:56774769-56774791 CTTCCTGTTCAGAGGGTGGAGGG - Intronic
1127998841 15:64172103-64172125 CGTGCACTGTAGATGGTGGGTGG - Intronic
1130648790 15:85750598-85750620 CTTGCCCTGCTGAGGGTGTCTGG - Intergenic
1131469378 15:92683208-92683230 CTTGCTCTGCTGAGAAAGGGAGG - Intronic
1131872715 15:96778295-96778317 ATTGAACAGCAGAGGGTGGGGGG - Intergenic
1132018510 15:98339793-98339815 CTGGCTTTGAAGAGGGTGGAAGG - Intergenic
1202989652 15_KI270727v1_random:447601-447623 CTTGCTGAACAGAGGATGGGAGG - Intergenic
1132488245 16:208805-208827 CTTACTCTGAAAAGGGTGGTGGG + Intronic
1132488568 16:211264-211286 CTTACTCTGAAAAGGGTGGTGGG + Intronic
1132533534 16:466122-466144 CTTGCTCTGCACAATGTGGCTGG + Intronic
1132608750 16:804695-804717 TTTGCTCAGCCGAGGGTGGTGGG + Intergenic
1132979016 16:2725442-2725464 CTGGCTCTGCAGATGGAGGAAGG - Intergenic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1135562530 16:23487692-23487714 TTAGGTTTGCAGAGGGTGGGAGG - Intronic
1136054845 16:27680686-27680708 CTTTTTTTGCAGAGGGAGGGTGG + Intronic
1136451893 16:30358311-30358333 CTGGCTCTGCGGACGGGGGGCGG + Exonic
1136535301 16:30896044-30896066 CTTGTTCTCCTGGGGGTGGGGGG + Intergenic
1136708554 16:32212184-32212206 CCAGCTCAGCAGAGGCTGGGAGG + Intergenic
1136759353 16:32717228-32717250 CCAGCTCAGCAGAGGCTGGGAGG - Intergenic
1136772006 16:32848219-32848241 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1136808754 16:33153158-33153180 CCAGCTCAGCAGAGGCTGGGAGG + Intergenic
1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1138724236 16:59118502-59118524 CCTTGTCTGCAGTGGGTGGGTGG + Intergenic
1139655189 16:68383181-68383203 CTTGCTCTGCACAGTGTAGGTGG - Intronic
1140135127 16:72199050-72199072 CTTGCGCTGCCTAGGGTGAGTGG + Intergenic
1140409769 16:74734614-74734636 CCTGCTGCCCAGAGGGTGGGCGG + Intronic
1140743735 16:77963343-77963365 CTGGCTTTGAAGACGGTGGGAGG + Intronic
1141693523 16:85609513-85609535 CTTGAACCACAGAGGGTGGGCGG - Intergenic
1142046128 16:87926447-87926469 CTCGCCTTGCAGCGGGTGGGAGG - Intronic
1142151281 16:88513547-88513569 CTTCCTGGGCAGAGGGTGTGTGG + Intronic
1142246933 16:88974493-88974515 TGTGCTGTGCAGGGGGTGGGAGG - Intronic
1203061508 16_KI270728v1_random:977537-977559 CCAGCTCAGCAGAGGCTGGGAGG - Intergenic
1203074427 16_KI270728v1_random:1110308-1110330 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1142852259 17:2709961-2709983 CTAACTCTGCTGGGGGTGGGGGG - Intronic
1142889367 17:2933017-2933039 CTTGCTTGGCAGAGGGGAGGAGG + Intronic
1144062341 17:11594561-11594583 CTTTCTCTGTAGAGAGAGGGGGG - Intergenic
1144675428 17:17158619-17158641 CTGGCTCAGGAGCGGGTGGGCGG + Exonic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1146693626 17:34893028-34893050 CGGGCTCTGCAGAGGGTGCGTGG + Intergenic
1147420300 17:40319087-40319109 TTTGCTCTGCTGAGGGTGTCTGG + Intronic
1147896871 17:43757003-43757025 CTTGCTCTTCAGAGTGGGGGTGG - Intronic
1148228484 17:45916290-45916312 TGTGCTCTGCAGAGGGCGGGTGG + Intronic
1148467042 17:47871552-47871574 CATGCTATGCAGAGAGTTGGAGG - Intergenic
1149268735 17:54954508-54954530 CTGGCTCTGCAGAGTTTGGAGGG + Intronic
1150249429 17:63698007-63698029 CTTGCCCTGCAGAGGCAGGGTGG + Exonic
1151353906 17:73547207-73547229 CCTGCCCTGCAGAGGGGGCGTGG - Intronic
1151699570 17:75736192-75736214 TTCTCTCTGGAGAGGGTGGGTGG - Intronic
1152239661 17:79154813-79154835 CTTGCTCAGTAGAGGGTTTGGGG - Intronic
1152744441 17:82032327-82032349 CTTGCTGGGCAGAGGGTCCGAGG + Intronic
1152815742 17:82406717-82406739 CTTGGGAGGCAGAGGGTGGGAGG - Intronic
1153205222 18:2692103-2692125 CTTGGGCTGCAGAGGTTGGAAGG - Intronic
1153496490 18:5704927-5704949 CTAACTCTCCAGAGGGTGGCTGG - Intergenic
1154122778 18:11665067-11665089 GATGCTGTGCAGAGGGTGGCAGG - Intergenic
1154229447 18:12541306-12541328 TGTACTCTGCAGTGGGTGGGTGG + Intronic
1154339330 18:13490071-13490093 CTTGCTCTTCAGAGACTAGGAGG + Intronic
1155308094 18:24498668-24498690 CTTGGCCTGCCGAGGGTGGAGGG + Intergenic
1158408782 18:57186348-57186370 GTTTCTCTGCAGGGGGTTGGGGG + Intergenic
1158537621 18:58322600-58322622 CTTGCTGTGGTGTGGGTGGGTGG + Intronic
1159011046 18:63058647-63058669 CTTGAGCTGCAGTGGGTTGGAGG + Intergenic
1160127975 18:76196060-76196082 TTTACTCTGGAGTGGGTGGGTGG - Intergenic
1160313682 18:77821016-77821038 CGGGCTGTGCAGAGTGTGGGGGG + Intergenic
1160411377 18:78677644-78677666 CTGGCTCAGCCGAGGGTGTGAGG - Intergenic
1160622705 18:80181781-80181803 CATGCTCTGCACAGGGGGAGAGG - Intronic
1160717971 19:584968-584990 CATGCTCTGTACCGGGTGGGAGG + Intergenic
1160799789 19:962454-962476 CTGGCTCTGCAGTGGGCGGGAGG - Intronic
1161259186 19:3326905-3326927 CTGGCTCTGCCCAGGCTGGGTGG - Intergenic
1161582191 19:5087050-5087072 CCTGCTCTGCAGAAGACGGGAGG - Intronic
1163819403 19:19487482-19487504 CTTGCTGGGCCGAGGGTGGGTGG + Intronic
1165837659 19:38769711-38769733 CCTGCCCTGGAGTGGGTGGGCGG - Intronic
1165859198 19:38898403-38898425 CTGGGTCTCCAGAGGGTGAGAGG + Exonic
1166379925 19:42350498-42350520 CTTGATCTGCAGAGCCTGGTGGG + Intronic
1166454395 19:42928698-42928720 CTCCCTCTGCAGAGGGCAGGTGG + Intronic
1166877126 19:45904045-45904067 CCTGCTGTGTGGAGGGTGGGTGG + Intergenic
1167455021 19:49593395-49593417 ATAGCTTTGCAGTGGGTGGGGGG - Exonic
1168155092 19:54469426-54469448 CTTGCTCTGCTGTGGGTCAGAGG + Intronic
925084709 2:1099184-1099206 CTTGCTCTGGAGAGCAGGGGAGG - Intronic
925187225 2:1856995-1857017 CTTGCTCTGCAGGTGATGGTGGG - Intronic
925894589 2:8461519-8461541 CTGGATCTCCAGTGGGTGGGAGG + Intergenic
926194688 2:10755648-10755670 GTGGCTCTGGAGAGGGTGGAGGG - Intronic
926418672 2:12675725-12675747 CTGGCAGAGCAGAGGGTGGGAGG - Intergenic
926579461 2:14618813-14618835 CGTGCTCTGCAGACAGTGGGAGG - Intergenic
927027208 2:19081027-19081049 CTCACACTGCAGGGGGTGGGGGG - Intergenic
927207523 2:20619457-20619479 CCTGCTTTGCTGTGGGTGGGAGG - Intronic
927465648 2:23334460-23334482 TTTGCTGTGCTGTGGGTGGGGGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930514882 2:52393854-52393876 CTTGCTCTGCAAAGGGACTGAGG - Intergenic
931718135 2:65045755-65045777 CTTTCTCTGCGGGGGGTGGGGGG - Intergenic
932599374 2:73113100-73113122 CGGCCTCTGCAGAGGGTGGGCGG + Intronic
932904798 2:75738337-75738359 CTTGGTTTGCAGTGGGCGGGTGG - Intergenic
935094417 2:99930681-99930703 CCTGCTATGCAGATGGGGGGAGG + Intronic
935815744 2:106844226-106844248 CTTGTTTTGCAGAGGTTGGTGGG - Intronic
936438457 2:112529109-112529131 CTAGGGCTGCAGTGGGTGGGAGG - Exonic
936530689 2:113275290-113275312 CTTGCATTGTGGAGGGTGGGGGG + Intronic
936684067 2:114806916-114806938 CTAGCTGTGCAGACGGTGAGAGG - Intronic
936932037 2:117799755-117799777 CTTGCAAAGCAGAGGCTGGGGGG - Intergenic
937100505 2:119264631-119264653 CTGGTTCTGCAGAGGGTTGGGGG - Exonic
937222690 2:120350895-120350917 CTTGAACTGCTGAGGATGGGGGG + Exonic
937223796 2:120356844-120356866 CCTGCTCTGCACAGGAGGGGAGG - Intergenic
937451155 2:122003061-122003083 CATACTCTGCAGAGACTGGGTGG + Intergenic
937451193 2:122003202-122003224 CATACTCTGCAGAGACTGGGTGG + Intergenic
938055120 2:128208808-128208830 CTCGCTTGCCAGAGGGTGGGCGG - Intergenic
938055249 2:128209398-128209420 CTCGCTTGCCAGAGGGTGGGCGG - Intergenic
938127098 2:128682454-128682476 CTTGCTGTGCAGAGAGGGGGTGG + Intergenic
938324380 2:130388440-130388462 GCTGCTCTCCAGAGAGTGGGTGG + Intergenic
938391968 2:130914042-130914064 CTTGTTCTGCAGGGGATGTGGGG - Intronic
938962924 2:136359182-136359204 CTTGCTCTGCAGACAGAGGTGGG + Intergenic
940209664 2:151243402-151243424 CTTACTCAGCAGAGGGTGTCAGG - Intergenic
941095576 2:161237438-161237460 CCTGCTCTACAGAGGGAGCGCGG + Intergenic
941917880 2:170823849-170823871 CCTGGCCTGCTGAGGGTGGGGGG + Intronic
942153902 2:173107226-173107248 CTTGCTCTGCAGAGCTTGGTGGG - Intronic
944100365 2:196019900-196019922 CTTGCTGTGCGGGGAGTGGGTGG - Intronic
945340261 2:208644275-208644297 CCTGCTCTTCAGGTGGTGGGTGG + Intronic
945449372 2:209976196-209976218 ATGGCTCTGCGGAAGGTGGGAGG + Exonic
947119758 2:226801308-226801330 CTTGCACTGCAGAGGGAAGGTGG + Intergenic
947590009 2:231380098-231380120 CGTGATGTGGAGAGGGTGGGTGG + Intergenic
948070137 2:235114212-235114234 CGGGCTCTGCCTAGGGTGGGAGG - Intergenic
948237916 2:236404091-236404113 CTTCCTCTACACAGGGTGGGTGG + Intronic
948798413 2:240418923-240418945 TGTGCTTTGCAGAGTGTGGGCGG + Intergenic
948860376 2:240750013-240750035 CTTGCTCTGCAGCAGGCTGGGGG + Intronic
1168944289 20:1738735-1738757 CCCTCCCTGCAGAGGGTGGGGGG + Intergenic
1169312833 20:4561684-4561706 CTTGCACTTGAGAGGGTAGGGGG - Intergenic
1170257381 20:14360095-14360117 CTTGCTGGGCACAGGGTGGTGGG + Intronic
1170525176 20:17228891-17228913 GTTGCTCTGGAAAGCGTGGGTGG + Intronic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174395097 20:50242508-50242530 CTTTCCCTCCAGAAGGTGGGTGG + Intergenic
1175033880 20:55981534-55981556 CCTTCCCTGAAGAGGGTGGGAGG - Intergenic
1175151539 20:56939007-56939029 CTGGCTCTGCATAGAGTTGGGGG - Intergenic
1175202736 20:57289355-57289377 CATCCTCTGCATGGGGTGGGGGG + Intergenic
1175572893 20:60037405-60037427 CTTGCCCTTCAGAGGGTTTGAGG + Intergenic
1176179176 20:63741539-63741561 CTTGCCCCACAGAGGCTGGGTGG - Intronic
1178580044 21:33830883-33830905 CTTGCAGAGAAGAGGGTGGGGGG + Intronic
1179659319 21:42864451-42864473 CATGCCCTGCAGAGGGATGGAGG + Intronic
1179784508 21:43721839-43721861 TTTGCTCTGCCCAGGGAGGGTGG - Intronic
1179951737 21:44712163-44712185 TGTGCTCTGCGGGGGGTGGGGGG + Intergenic
1182516095 22:30859934-30859956 CTAGCTCTGCAGAGAGGGGCCGG - Intronic
1182555635 22:31127095-31127117 CTTGCTGTGCATGGGGCGGGGGG - Intronic
1183426372 22:37741530-37741552 CCTGCTGTGAAGCGGGTGGGAGG - Intronic
1183743722 22:39681713-39681735 CCTGCCCTGCTGGGGGTGGGGGG + Intronic
1183749434 22:39711422-39711444 CCTGCTCGTCAGGGGGTGGGGGG + Intergenic
1184058956 22:42070551-42070573 CCAGCACTGCAGAGGGTGTGAGG - Exonic
1184172738 22:42769283-42769305 CTTGAGGGGCAGAGGGTGGGGGG + Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184357000 22:43988618-43988640 CTCGCTGTGCAGTGGGTGGCAGG + Intronic
1184837286 22:47031539-47031561 TTTGCCCTGAGGAGGGTGGGTGG + Intronic
1185034849 22:48468397-48468419 CTGCCTCTGCAGAGGGTGAATGG + Intergenic
1185282231 22:49977841-49977863 CCTGCTCTGCAAAGGGCGGCAGG - Intergenic
949723652 3:7019065-7019087 CTTCCTCTGGAGAGGGAGGCTGG - Intronic
949889566 3:8723755-8723777 CTGGCTCTGCAGAGGTGAGGAGG - Intronic
949948960 3:9213373-9213395 CTTGCTCTGAGGAGTGTGGAGGG - Intronic
950202010 3:11051035-11051057 CTTGCGCTACAGAGGGGTGGGGG + Intergenic
950408097 3:12816990-12817012 CCTGCACGGCAGACGGTGGGAGG - Exonic
950487089 3:13280365-13280387 CTTGCTCTGCAGATGGGCAGTGG + Intergenic
952420987 3:33131290-33131312 CGTGTTCTGAAGAGGATGGGAGG - Intronic
952764515 3:36943482-36943504 CATCCTCTGCGGGGGGTGGGGGG - Intronic
953417025 3:42728391-42728413 CTTGCACAGGGGAGGGTGGGGGG - Intronic
953437159 3:42887222-42887244 CTTGGGTTGCAGGGGGTGGGGGG - Intronic
954326392 3:49866527-49866549 GTTCCTCTGCAGAGAGTGGAGGG - Intronic
954774054 3:52999796-52999818 CTTGGTCTGTAGAGCTTGGGGGG - Intronic
955320949 3:57973811-57973833 CTTGGGATGCAGGGGGTGGGAGG + Intergenic
956995637 3:74824231-74824253 CTTGTTCTGGTGGGGGTGGGAGG + Intergenic
957274758 3:78076535-78076557 CCTGGTTTGCAGAGGTTGGGAGG + Intergenic
959920048 3:111859686-111859708 GTTGCGCTGCGGAGGGTTGGGGG + Intronic
960089803 3:113627804-113627826 TTGGCTCTACAGAGGGTGAGTGG - Exonic
961060600 3:123825342-123825364 ATAGATCTGCAGAGGTTGGGTGG - Intronic
961578143 3:127855423-127855445 CTGGCTCTGAAGATGGAGGGAGG - Intergenic
962316100 3:134360403-134360425 CTTGCTCTGCAGAGACAGGCAGG - Exonic
962440878 3:135415149-135415171 ACTGCTCTGCAGAGGGTTGGTGG + Intergenic
962840394 3:139227308-139227330 CTGACTCTGCAGAGTGGGGGTGG + Intronic
963043068 3:141083355-141083377 AGGGCTCTACAGAGGGTGGGGGG - Intronic
965184996 3:165451809-165451831 CTTGCTCTGGTGGAGGTGGGAGG - Intergenic
966923979 3:184632815-184632837 CTTGCTCTGCTGGGGCTGGGAGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967814465 3:193787435-193787457 CCTGCTCTGCAGACAGAGGGAGG + Intergenic
968478863 4:825358-825380 CTTCCTCTGCGGAGGGCGAGGGG - Intronic
968867926 4:3225615-3225637 CTTGATCTGCACAGGGGGGCAGG - Intronic
970200458 4:13599639-13599661 CTTGCCCTGCAGAGGGCTTGTGG + Exonic
971403336 4:26296709-26296731 CTTGCTCTTCAGAGAGGGTGTGG - Intronic
972048870 4:34702885-34702907 CCTGCTCTGGAGATGGTGGCAGG - Intergenic
974539741 4:63218902-63218924 CTGGCTCTGGAGAGTCTGGGTGG - Intergenic
976883817 4:89962407-89962429 CTTGCTCTCTCCAGGGTGGGGGG + Intergenic
977726507 4:100302673-100302695 CTCCATCTGCAGTGGGTGGGGGG - Intergenic
977764110 4:100777134-100777156 CTATCTCTACAGAGGGAGGGTGG + Intronic
978968106 4:114767815-114767837 ATTGCAGGGCAGAGGGTGGGAGG + Intergenic
979277141 4:118827157-118827179 CTTGGTGTGGAGAGGCTGGGAGG + Intronic
980859561 4:138482826-138482848 CTGGCTCTGCAGAGGTAGAGAGG - Intergenic
981227958 4:142318987-142319009 ATTGCTGTCCTGAGGGTGGGAGG + Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981420677 4:144546682-144546704 CTTTCTTTCCAGGGGGTGGGTGG + Intergenic
981661771 4:147175638-147175660 CTGGCTTTGAAGATGGTGGGAGG + Intergenic
985551177 5:534387-534409 CTGGCTCAGCACAGGGTAGGGGG + Intergenic
985648802 5:1098088-1098110 CTGGGTGTGCAGAGGGTTGGAGG - Intronic
985730707 5:1546719-1546741 CCTGCTTTGCAGAGGATGGAAGG - Intergenic
985985654 5:3513971-3513993 GGAACTCTGCAGAGGGTGGGAGG - Intergenic
987378575 5:17261617-17261639 TTTGTTATGCAGACGGTGGGGGG - Intronic
990207716 5:53448001-53448023 AGTGCTTTACAGAGGGTGGGTGG + Intergenic
990622176 5:57571550-57571572 CTTGCTTTGCTGAGGCTGGGTGG + Intergenic
991227766 5:64292693-64292715 CTGGCTCTGCAGAGTCTAGGTGG - Intronic
993575336 5:89592534-89592556 CTTGCTCTGCAGAGGGAAATAGG - Intergenic
995752308 5:115465682-115465704 TTTGCTGTGCAGAGGGTGTTTGG - Intergenic
997921851 5:137988269-137988291 CTTACTCTGTAGAGGCTGGTAGG + Exonic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
1000173706 5:158729044-158729066 CCTGCTCTGCAGAGATTGGGTGG + Intronic
1000414988 5:160975176-160975198 CTTTCCCTGTACAGGGTGGGGGG - Intergenic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1006147309 6:31967394-31967416 TTTGGACTCCAGAGGGTGGGAGG + Intronic
1006366423 6:33618842-33618864 TGTTTTCTGCAGAGGGTGGGAGG + Intergenic
1007904739 6:45448286-45448308 CTTGCTCTGCAGAGGTCATGTGG + Intronic
1010656598 6:78518594-78518616 CTTTCTCAGCAGAGGGTGATGGG - Intergenic
1010722992 6:79304717-79304739 CTTAATTTGAAGAGGGTGGGTGG - Intergenic
1011422306 6:87186059-87186081 TCTGCTCTCCAGAGGTTGGGGGG + Intronic
1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG + Intergenic
1013196637 6:107849992-107850014 CATGCTCTGGAGTGGGTGAGGGG - Intergenic
1013354230 6:109333087-109333109 CTTGCTCTCCAGAGACTGGGTGG + Intergenic
1015483515 6:133742205-133742227 CTAGCTGTGCTGAGGGTGAGAGG + Intergenic
1015535957 6:134268036-134268058 CTTGCTCTTGAGAGAGTGGCTGG + Intronic
1017429755 6:154359426-154359448 TTTGCTGTGCAGAGGCTGGGCGG - Intronic
1019309549 7:353414-353436 CAGGGTCTGCAGGGGGTGGGGGG + Intergenic
1019647603 7:2139402-2139424 CCTTCACTGCTGAGGGTGGGGGG - Intronic
1019815608 7:3197598-3197620 CCAGCACTGCAGAAGGTGGGGGG + Intergenic
1020086309 7:5312671-5312693 CTTGGGCTGCAGAGGCTGTGTGG + Exonic
1021270497 7:18578466-18578488 CCTTCTCTGCAGAGGGTTAGAGG + Intronic
1025207998 7:57004401-57004423 CTTGGGCTGCAGAGGCTGTGTGG - Intergenic
1025663953 7:63572474-63572496 CTTGGGCTGCAGAGGCTGTGTGG + Intergenic
1025916527 7:65871059-65871081 CTTGCTCTGCCCAGGTGGGGTGG - Intergenic
1026457414 7:70584738-70584760 CTTGCTCTGAAGAAGGAAGGGGG + Intronic
1027145045 7:75688414-75688436 CTGCGTCTGCAGGGGGTGGGGGG + Intronic
1028585572 7:92447935-92447957 GTTGCTCTGCGGAGGGGTGGCGG - Exonic
1030710218 7:112740436-112740458 CTTGTCTTGCAGAGGGTGAGTGG + Intergenic
1031986426 7:128167163-128167185 CGTGCTAGGTAGAGGGTGGGAGG + Intergenic
1034419233 7:150980243-150980265 CTTGGTCTGGAGAGAGGGGGAGG - Intergenic
1035872454 8:3150437-3150459 CTTGCTCAGCAGAGAGTGGCCGG - Intronic
1037896269 8:22658542-22658564 CTGCCTCTGCAGAGGGAGTGAGG - Intronic
1038446109 8:27605394-27605416 CTGGCTCACCAGGGGGTGGGAGG - Intronic
1038493975 8:27988977-27988999 GTTTCTCTTCAGAGGGAGGGTGG + Intronic
1038619179 8:29123813-29123835 CTTTCTTTGTAGGGGGTGGGAGG + Intronic
1039663020 8:39487748-39487770 CTTGTTCTGCAGAAGGAAGGGGG - Intergenic
1041717788 8:60947922-60947944 CATGCTCTTGAGAGGGTGAGGGG - Intergenic
1041746865 8:61216710-61216732 CTTGCTTTGCACAGGTTGAGGGG - Intronic
1042985658 8:74580279-74580301 CTGGCTCTGAAGATGGAGGGGGG - Intergenic
1043148181 8:76681868-76681890 TTTGCTCCGCTGAGGGAGGGAGG + Intronic
1043618741 8:82160845-82160867 CTTGCTGAGCAGCGGGTGGTGGG + Intergenic
1044866262 8:96574046-96574068 CTAGCTATGCAGAGGGGAGGGGG - Intronic
1045055625 8:98365637-98365659 GTTGCTCTGGGGAGGGAGGGAGG - Intergenic
1045960704 8:107964690-107964712 TCTGCTTTGCAGGGGGTGGGGGG + Intronic
1046050482 8:109015895-109015917 CTAGCTCGGCAGTGGTTGGGTGG - Intergenic
1048411457 8:134178402-134178424 CTAGCTCTTAATAGGGTGGGTGG - Intergenic
1048906832 8:139096691-139096713 CTGGCTCTGCAGGGGTTGAGTGG + Intergenic
1049009116 8:139875586-139875608 CTTGCCCGGCAGTGGGTGTGGGG - Intronic
1049299132 8:141860610-141860632 ATGGCTCTGCTCAGGGTGGGAGG - Intergenic
1049312790 8:141942379-141942401 GCTGCTCTGCAGAAGGTGGCTGG + Intergenic
1049555191 8:143278101-143278123 CATGGTCTGGAGAGGGTGGCGGG - Intergenic
1049657982 8:143807207-143807229 ACTGCTCTGCAGAGCGTGGTGGG + Intronic
1050279429 9:4034850-4034872 CTTCTTCTTCAGAGGGTGAGTGG + Intronic
1050457253 9:5846039-5846061 CTGGGTCTGGAGAGGTTGGGTGG + Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1052857650 9:33417137-33417159 CTTGCTCTGAAAGGGGTAGGAGG - Intergenic
1052988115 9:34502486-34502508 GTTGCTCCTCAGAAGGTGGGAGG + Intronic
1053001101 9:34577788-34577810 CTGCCTCTGCAGCCGGTGGGAGG - Intronic
1054928806 9:70615367-70615389 TTTGTTCTGCAGAGGGAAGGGGG - Intronic
1055585328 9:77753305-77753327 CTTTTTCTTCAGGGGGTGGGTGG - Intronic
1055610449 9:78018956-78018978 ATTCTTCTGCAGCGGGTGGGAGG - Intronic
1057866649 9:98686934-98686956 CTGACTCTGCTGAGGGAGGGTGG - Intronic
1060208415 9:121696210-121696232 CTCTCTCTGAAGTGGGTGGGGGG - Intronic
1060340178 9:122768210-122768232 CTGGCTCTGGAGAGCCTGGGTGG + Intergenic
1061808946 9:133151442-133151464 TGTGCTCTGCACAGGGTGGGAGG - Intergenic
1185824042 X:3232055-3232077 CTCGCATGGCAGAGGGTGGGAGG + Intergenic
1186344261 X:8675333-8675355 CTTTCTCTGCTGAGCGTGGCAGG - Intronic
1187440290 X:19311912-19311934 CCTGCCCTGAAAAGGGTGGGAGG - Intergenic
1190151527 X:47954052-47954074 CTCTCTCTGCAGATGGTGGCAGG + Intronic
1190259574 X:48789644-48789666 CTTCCTCTGAAGAGGGTGGCAGG - Intronic
1190635003 X:52424803-52424825 GTCAGTCTGCAGAGGGTGGGAGG - Intergenic
1190649694 X:52556885-52556907 GTCAGTCTGCAGAGGGTGGGAGG + Intergenic
1190654267 X:52597328-52597350 GTCAGTCTGCAGAGGGTGGGAGG + Intergenic
1194005844 X:88491013-88491035 GTGGCTTTGCTGAGGGTGGGGGG + Intergenic
1194263959 X:91733371-91733393 CTGGCTCTGGAGAGTCTGGGTGG - Intergenic
1196463260 X:115950274-115950296 TTTCCTCTGCAAAGGGTGGAGGG - Intergenic
1200372234 X:155739383-155739405 CTGGCTCTGGAGAGTCTGGGTGG + Intergenic
1202583922 Y:26405653-26405675 CTTGCCTTGCCGCGGGTGGGTGG - Intergenic