ID: 907987744

View in Genome Browser
Species Human (GRCh38)
Location 1:59549197-59549219
Sequence CTCTGGAGCCCTTCCTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 352}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907987744 Original CRISPR CTCTGGAGCCCTTCCTCTCC AGG Intronic
901571092 1:10161283-10161305 CTCTGGACCACGTCCTCACCCGG - Exonic
901803170 1:11721087-11721109 TTCTGGAGCACTTCCCCCCCAGG + Exonic
901875228 1:12163676-12163698 CACTGGAGGCCTTCATGTCCTGG - Intergenic
902053757 1:13583873-13583895 CTCGGGCACCCTCCCTCTCCGGG + Exonic
902463974 1:16603212-16603234 CTGTGGCGCCCATCCTCTGCAGG - Intronic
904337647 1:29808583-29808605 CTCTGGAGCCCTTTCTCTAAGGG + Intergenic
905096748 1:35478788-35478810 CTCTAGAGCCTTTCCTCAGCAGG - Intronic
906284302 1:44576585-44576607 CACTGGGGCCCATCCTGTCCTGG - Intronic
907416589 1:54318657-54318679 CTATGGACACATTCCTCTCCTGG - Intronic
907458311 1:54590207-54590229 CTCTAGAGTCCTTCATCACCTGG + Intronic
907710347 1:56875180-56875202 CTCCTGAGCCCTTCCTCTCGAGG + Intronic
907987744 1:59549197-59549219 CTCTGGAGCCCTTCCTCTCCAGG + Intronic
908125719 1:61028180-61028202 CTATGGAGGCCTTCCTTTCACGG + Intronic
910210107 1:84783600-84783622 CTCAGGCTCCCTTCCTTTCCAGG - Intergenic
910314677 1:85868798-85868820 CCCTGGAGACCTTCTTCTCCAGG + Exonic
911498910 1:98661988-98662010 CTCTGGCGCGCTTGCCCTCCCGG + Intronic
912285571 1:108365063-108365085 CTCTGGTCCTCTTCCTCTCCTGG + Intergenic
912738044 1:112167611-112167633 CTCTGGGGCCCTTCCTTTAATGG + Intergenic
914386184 1:147172287-147172309 CCCTGGAGCCCTCTCCCTCCTGG + Intronic
915612637 1:157006836-157006858 CACTGGGGCCCTTCATCTTCTGG - Intronic
916214863 1:162385809-162385831 CTCTGGGGCTTCTCCTCTCCTGG + Intronic
919838115 1:201590623-201590645 CCCTGCAGCCCTTCCTCAGCTGG - Intergenic
920198905 1:204247346-204247368 CTCAGGGGCCCTTCTTCACCTGG + Exonic
920245042 1:204581118-204581140 CTCTGAAGTGCTTCCTCTCCTGG + Intergenic
922209106 1:223474075-223474097 CTCCTGAGCCCATCCTCCCCAGG + Intergenic
922558126 1:226548665-226548687 CTCTGACGCCCCTCCTCGCCAGG - Intergenic
924030228 1:239878874-239878896 TGCTGGAGCCCTTCCTCCTCAGG - Intronic
924436396 1:244047984-244048006 CCCGGGTGCCCTGCCTCTCCAGG + Intergenic
924617285 1:245622757-245622779 CTCTGGATCCCTATCTTTCCAGG - Intronic
1063003249 10:1944531-1944553 CTCGGGAGCCCTCCCACACCTGG + Intergenic
1063038995 10:2317685-2317707 CTCAGGAGCTCATCCTGTCCAGG + Intergenic
1063039507 10:2322461-2322483 CTCAGGAGCCCTCTCTCTGCAGG - Intergenic
1063096550 10:2913534-2913556 ATCTCGAGTCCTGCCTCTCCTGG - Intergenic
1064020897 10:11807892-11807914 TTCTGTTGTCCTTCCTCTCCCGG - Intergenic
1064687543 10:17879298-17879320 CTCTGGAGGTCTCCCTCTTCTGG + Intronic
1064889875 10:20159133-20159155 CTCTCCAGCGCTTCCTCTCCTGG + Intronic
1067145654 10:43691917-43691939 CCCTGATGCCATTCCTCTCCAGG - Intergenic
1067815893 10:49476688-49476710 ACCTGGAGCTCTCCCTCTCCTGG + Intronic
1067978100 10:51049081-51049103 CGCGGGAGCTCTTCCTTTCCCGG - Intronic
1068171120 10:53395913-53395935 CTCTGGAGCCCATCCCTTCTGGG + Intergenic
1069016444 10:63434532-63434554 CTCTGGAAATCTTCCTCTCTCGG - Intronic
1069923334 10:71831058-71831080 CTCTGGGCCACTGCCTCTCCTGG + Intronic
1071514899 10:86290934-86290956 CCCTGGGCCGCTTCCTCTCCAGG - Intronic
1072756007 10:98021404-98021426 CTCTGTGGCACTTCCTCACCTGG - Intronic
1074544461 10:114391851-114391873 CTCTGCAGCCATTCCTCACTTGG - Intronic
1075284049 10:121167576-121167598 CTCTGGAGCCCTTGCTTGCCAGG - Intergenic
1076726122 10:132414145-132414167 CGCAGGAGCCTTCCCTCTCCCGG - Intronic
1076876786 10:133220141-133220163 CGCCTGAGCCCCTCCTCTCCTGG - Intronic
1076876796 10:133220173-133220195 CGCCTGAGCCCCTCCTCTCCTGG - Intronic
1076876806 10:133220205-133220227 CGCCTGAGCCCCTCCTCTCCTGG - Intronic
1076876826 10:133220269-133220291 CGCCTGAGCCCCTCCTCTCCTGG - Intronic
1076876846 10:133220333-133220355 CGCCTGAGCCCCTCCTCTCCTGG - Intronic
1076876874 10:133220429-133220451 CGCCTGAGCCCCTCCTCTCCTGG - Intronic
1076876924 10:133220589-133220611 CGCCTGAGCCCCTCCTCTCCTGG - Intronic
1076876944 10:133220653-133220675 CGCCTGAGCCCCTCCTCTCCTGG - Intronic
1076876964 10:133220717-133220739 CGCCTGAGCCCCTCCTCTCCTGG - Intronic
1076925403 10:133481270-133481292 CTCTGAAGACCTTCCACTCCAGG + Intergenic
1076995872 11:297288-297310 CTCCGGGGCCCTTCCCTTCCCGG - Intergenic
1077443830 11:2581103-2581125 CTCTGGAGCCCTCTTGCTCCAGG + Intronic
1079360731 11:19768284-19768306 CTCTGCAGCCCTTCCTCTGGGGG + Intronic
1081070613 11:38605161-38605183 CTCAGAAGTCCTTCGTCTCCTGG - Intergenic
1081811161 11:45914875-45914897 CTCTGCAGCCCTCCCTAGCCTGG + Intronic
1081870327 11:46380254-46380276 CTCTCCAGCCCCTCCACTCCTGG - Exonic
1081933552 11:46889270-46889292 CTCTTAAGTTCTTCCTCTCCAGG + Intronic
1083433460 11:62627071-62627093 CTCTGGAGCCCATGGTGTCCAGG - Exonic
1083519588 11:63296011-63296033 CTCTGGAGTGCATCCTGTCCTGG - Intronic
1084118716 11:67056721-67056743 GGCTGGGGCCCTTCCTCTCCAGG - Intergenic
1084144139 11:67255178-67255200 CCCTTGAGCCCTTCCTCTACAGG + Exonic
1084483377 11:69434610-69434632 GTCTGGAGCCCTCCCTCCCCAGG - Intergenic
1085629129 11:78098540-78098562 GTCTGGAGCCATTTCCCTCCCGG + Intergenic
1087045003 11:93837489-93837511 CTCTGAAGCCCTTGCTTCCCTGG - Intronic
1088141035 11:106616672-106616694 CTCTTCAGCCCTACCTCTACTGG + Intergenic
1088645330 11:111912737-111912759 CTATCGAGCCCTGGCTCTCCGGG + Exonic
1088893184 11:114060109-114060131 CTCCCCAGCCCTTCCTCTTCAGG + Intronic
1089378287 11:118010693-118010715 CCCTGCAGCCCCTCCCCTCCTGG - Intergenic
1089399823 11:118157918-118157940 CTCTGCCGCATTTCCTCTCCAGG - Intergenic
1089403955 11:118181983-118182005 TTCTGAAGCCCTTCCTTACCAGG + Intergenic
1089523068 11:119078543-119078565 CTCTGCCCTCCTTCCTCTCCAGG + Exonic
1089921797 11:122215907-122215929 GACTTGAGCCTTTCCTCTCCAGG - Intergenic
1090628029 11:128622765-128622787 GCCTGGAGCTCTTCCCCTCCTGG - Intergenic
1090630047 11:128637913-128637935 ATCTGGAGCTCTCACTCTCCTGG + Intergenic
1090664204 11:128904242-128904264 CACTGGACGCCTTCCTCACCAGG + Intronic
1090709004 11:129369267-129369289 CTCTGTAGCCTTCCCTCACCCGG - Intergenic
1090808549 11:130217896-130217918 CTCTCCAGCCCTTCCCCTCTAGG - Intergenic
1091160706 11:133417033-133417055 CTCTGGGCACCTTACTCTCCAGG - Intronic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1091400983 12:180564-180586 CTCTCAAGCACTTCCTCTCCTGG - Intergenic
1094300568 12:28960146-28960168 CTCTCTATCCCTTCCTCTCTAGG + Intergenic
1095413740 12:41952726-41952748 GTCTGGATCCCTTCCTCTTTGGG - Intergenic
1096469045 12:51864834-51864856 CCCTGGAGCTCTTCCACTCCCGG - Intergenic
1096687128 12:53295636-53295658 CTCTGGGGCCCGTCCCCACCTGG - Exonic
1096814510 12:54193474-54193496 CTCTGGTGTCCTCCATCTCCTGG + Intergenic
1096817046 12:54208396-54208418 CTCTTGGCCCCTTCCTCTCTGGG - Intergenic
1097147876 12:56954122-56954144 CTCTGGGGCTCTTCCTCTCTAGG - Intronic
1098557398 12:71835048-71835070 CTCTGGAGCCCATGCAGTCCTGG - Intergenic
1099690826 12:85949137-85949159 CACTGCTGCCCTTCCTCTCCGGG + Intergenic
1101428401 12:104606478-104606500 TACTGGAGACCTTCCTCTTCGGG - Intronic
1102349268 12:112180105-112180127 CTCTGGACTGCTCCCTCTCCTGG + Intronic
1102559757 12:113753822-113753844 CCCTGGACCCCTTGCTCTCTGGG - Intergenic
1103205502 12:119125618-119125640 CTCTCCAGCCCTTTCTCTACAGG - Intronic
1103342477 12:120228476-120228498 GTCTGCACCCCTTCCTCACCAGG - Intronic
1103408532 12:120693715-120693737 CTCTGAAGCCCTCCCTCTTGGGG + Intronic
1103724463 12:122990851-122990873 CTCTGGGCCCCTTCCTCTCACGG - Intronic
1105497703 13:20945225-20945247 GTCTGGATCGCGTCCTCTCCTGG + Intergenic
1105754888 13:23454846-23454868 CTCTGGAGCCATGCCTCGTCGGG - Intergenic
1105927696 13:25021996-25022018 CTCTGCAGTCCTTACTCACCAGG + Intergenic
1106226475 13:27790535-27790557 CTCTTAACCCCTTCCTCCCCGGG + Intergenic
1107787739 13:43971505-43971527 CTCTCCAGCCCCTCCACTCCTGG - Intergenic
1108197782 13:48011922-48011944 CTCTGGAAAGCTTCCTCCCCAGG + Intergenic
1111143657 13:84154575-84154597 GTCTGGAGCACCTACTCTCCTGG - Intergenic
1112072792 13:95873646-95873668 AGATGGAGCCCTTCCTGTCCAGG + Intronic
1113653232 13:112052737-112052759 CTCTGGAGCCCCCCCCCCCCCGG + Intergenic
1114494850 14:23125693-23125715 CACAGGAGCCCTTCCTGGCCTGG - Exonic
1114503507 14:23190078-23190100 CTCTGGAGCACCCACTCTCCTGG + Intronic
1114907738 14:27151645-27151667 ATCTGGAGCACATACTCTCCTGG - Intergenic
1116195738 14:41723054-41723076 ATCTGGAGCACTCACTCTCCTGG - Intronic
1117322602 14:54638125-54638147 ATATGGAGTCCTTACTCTCCAGG + Intronic
1117742519 14:58833651-58833673 GTCTGGAGCCCTTGCTCTCTTGG - Intergenic
1118319928 14:64747119-64747141 CACTAGAGCCCTTCCTTTCTCGG + Exonic
1118965812 14:70584311-70584333 TTCTGTAACCTTTCCTCTCCCGG - Exonic
1119640194 14:76309000-76309022 CTCTAGAGCCCTGTCTCTGCAGG + Intergenic
1119886475 14:78147583-78147605 CTCTGGAGTCCTTCTAGTCCAGG + Intergenic
1120730730 14:87998144-87998166 CTCTGGAGCCCCAGGTCTCCTGG + Intergenic
1121039268 14:90731614-90731636 CTCTGCACCCCTGACTCTCCGGG + Intronic
1121529795 14:94644272-94644294 CTCTCCAGTCCTTCCTCCCCAGG - Intergenic
1122069469 14:99196263-99196285 CTTTGGAACCTTTCCTCCCCTGG - Intronic
1122147266 14:99699081-99699103 CCCAGAAGCCCTTCCTCTCCCGG + Intronic
1122239175 14:100350708-100350730 CTCTGTGGCCCATCCCCTCCTGG - Intronic
1123030784 14:105450130-105450152 ATCGGGAGCTGTTCCTCTCCCGG + Exonic
1123121163 14:105917791-105917813 AACTCGAGCTCTTCCTCTCCTGG - Intergenic
1123403865 15:20009360-20009382 AACTTGAGCTCTTCCTCTCCTGG - Intergenic
1123513205 15:21016006-21016028 AACTTGAGCTCTTCCTCTCCTGG - Intergenic
1124239308 15:28016961-28016983 CTCTGGGGCCCTTCCTTGCAGGG - Intronic
1124441476 15:29689096-29689118 CGCTGGAGCCCTCCCTCTCTGGG + Intergenic
1124633899 15:31353044-31353066 CTCTGCAGTCCCTCCTCCCCTGG - Intronic
1125372308 15:38991579-38991601 CTCTGGAGCCATTCCATTTCTGG - Intergenic
1126897536 15:53275063-53275085 CTCTGTCTCTCTTCCTCTCCCGG + Intergenic
1127252895 15:57259880-57259902 CTCTTTAACCCTTGCTCTCCTGG - Intronic
1129172288 15:73815578-73815600 CTCTGGATTCCTTGATCTCCTGG - Intergenic
1129608110 15:77034634-77034656 CACCTGAGCCCTCCCTCTCCTGG + Intronic
1130124575 15:81082370-81082392 CTCTGGACCACTTCTTCACCAGG + Intronic
1130555890 15:84922365-84922387 CTCTCAAGCCCTTCCCCTCTTGG + Intronic
1130715453 15:86329358-86329380 ATTTGGAGCACTTCCTCACCAGG + Intronic
1131021454 15:89102711-89102733 CTCAGGAGCTCTTCCTCCGCTGG - Intronic
1131161315 15:90106737-90106759 CTCTGGAGTCCTGCCTCTCTTGG - Intergenic
1131171718 15:90183971-90183993 TTCTGCAGCCTCTCCTCTCCGGG - Intronic
1132222931 15:100118417-100118439 CTCTAGATCTCTTCTTCTCCTGG - Intronic
1136054955 16:27681511-27681533 TACTGGAGCACATCCTCTCCTGG - Exonic
1136290443 16:29268349-29268371 CCCTTGAGCCTCTCCTCTCCAGG - Intergenic
1137402919 16:48167740-48167762 CACCAGGGCCCTTCCTCTCCAGG + Intronic
1139922500 16:70468947-70468969 CTCCGGAGCCCGGCCTGTCCAGG + Exonic
1140375887 16:74445400-74445422 CTCTGGCTCACTTACTCTCCGGG - Intergenic
1141445402 16:84054874-84054896 CTCTGCTGCCCTTCCTCCCTGGG + Intronic
1141538655 16:84700489-84700511 CTCTGGGGCCCCTGCGCTCCAGG - Intronic
1141897110 16:86965125-86965147 CTGTGGAGCCCTGCCTGTCCTGG - Intergenic
1142027546 16:87822692-87822714 CTCTGGGGCTCTTCGTCTCCAGG - Intergenic
1142096325 16:88241870-88241892 CCCTTGAGCCTCTCCTCTCCAGG - Intergenic
1143288362 17:5809436-5809458 CTCTGGAGCCCATCCCTTCTGGG - Intronic
1145748842 17:27340971-27340993 CTCTGGAAGCCTTAGTCTCCAGG + Intergenic
1147884020 17:43672459-43672481 CCCTGGTGTCCTGCCTCTCCTGG - Intergenic
1148200924 17:45749593-45749615 CTCAGGGGCCCTTCATCTCTTGG - Intergenic
1148618014 17:49014520-49014542 CTGTGGAGGTCTTCCTCCCCAGG - Intronic
1149112132 17:53046601-53046623 ATCTGGAGCGCGTGCTCTCCTGG + Intergenic
1150265278 17:63828206-63828228 CTCTGGAGTCCGTCCTCACCTGG - Exonic
1150436665 17:65159476-65159498 CTCCCCAGCCCTCCCTCTCCAGG - Intronic
1150682316 17:67293767-67293789 CTGCGAGGCCCTTCCTCTCCTGG - Intergenic
1150682915 17:67297463-67297485 CTGCGAGGCCCTTCCTCTCCTGG - Intergenic
1150700463 17:67442777-67442799 CACTGCAACCCTTCGTCTCCTGG - Intronic
1151651272 17:75471318-75471340 CTCTGTAGCCCTCTCCCTCCTGG + Intronic
1151708303 17:75784516-75784538 CTCTGGGCCCCTTCTCCTCCAGG + Intronic
1152389465 17:79994023-79994045 CTGGGGAGCACTGCCTCTCCAGG + Intronic
1153782967 18:8510272-8510294 CTCTGGAGTCCTTCATCATCTGG + Intergenic
1153821014 18:8831635-8831657 CCCTAGAGCCCTGCTTCTCCAGG + Exonic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1155376430 18:25163496-25163518 CTCTGCAGCCCTCACACTCCTGG - Intronic
1157570406 18:48708631-48708653 CTCTGAGGTCCTCCCTCTCCAGG - Intronic
1158967355 18:62634190-62634212 CTCTTCAGCCTGTCCTCTCCTGG + Intergenic
1159983433 18:74813602-74813624 CACTGGAGCCCTTCATCTTAGGG + Intronic
1160086022 18:75778263-75778285 CTCCGGAGCCCTCCCTGTGCTGG + Intergenic
1161576422 19:5056920-5056942 GTCTAGAGCCCTGCCTGTCCCGG + Intronic
1163294142 19:16401427-16401449 CCCTGGAGCCCTTCTGCTCCTGG - Intronic
1163472273 19:17504607-17504629 CTCTGAAGCTGTTCCTCTACTGG + Exonic
1163534378 19:17868805-17868827 CTCTGCTGCTTTTCCTCTCCAGG + Intergenic
1165363673 19:35351462-35351484 CCCAGGAGCCCCTCCTCTCCGGG + Intergenic
1165365806 19:35363910-35363932 CCCAGGAGCCCCTCCTCTCTGGG + Intergenic
1165776387 19:38406858-38406880 CCCTGGAGCCCTTCCCCACGTGG - Intronic
1165813658 19:38627782-38627804 CTCTGGGTCCCTTGCTCTCTTGG + Intronic
1166442097 19:42823896-42823918 CTCCCGGGCCCTGCCTCTCCTGG - Intronic
1166461521 19:42992179-42992201 CTCCCGGGCCCTGCCTCTCCTGG - Intronic
1166478814 19:43152164-43152186 CTCCCGGGCCCTGCCTCTCCTGG - Intronic
1166501487 19:43344495-43344517 CTCCCGGGCCCTGCCTCTCCTGG - Intergenic
1166504138 19:43361078-43361100 CTCTGGAGCCCCTGCTGCCCTGG + Intronic
1166506319 19:43373680-43373702 CTCTGGAGCCCCTGCTGCCCTGG - Intergenic
1166508629 19:43388963-43388985 CTCCCGGGCCCTGCCTCTCCTGG + Intergenic
1167466988 19:49655324-49655346 CTCTGGAGCTGTTTCTCTCTTGG + Intronic
1202679632 1_KI270711v1_random:40652-40674 CTGTGGCGCCCATCCTCTGCAGG - Intergenic
924968954 2:106343-106365 CTGAGCAGCCCTTCCCCTCCTGG + Intergenic
925044717 2:764050-764072 CTCTGGAGTCCCTCCTTCCCTGG + Intergenic
925371479 2:3348802-3348824 CTCTGGAGCTCCAGCTCTCCTGG - Intronic
926371678 2:12185004-12185026 CTCTAGCGCTCTTCCTCCCCTGG + Intergenic
927111146 2:19864494-19864516 CTATGGGGCCTTTCCTCTCTTGG + Intergenic
927481482 2:23457441-23457463 TTCTGGGGCCCTTCCCCTCCAGG + Intronic
928088382 2:28359576-28359598 CTCTGACGTCCGTCCTCTCCGGG - Intergenic
929479895 2:42295588-42295610 CACTGCAGCTCTTTCTCTCCTGG - Intronic
929557886 2:42936836-42936858 CTCTGGGCCCATCCCTCTCCAGG + Intergenic
929587958 2:43127842-43127864 CTCTGCAGCACTTCCTCCCCAGG - Intergenic
930011196 2:46940024-46940046 ATGTGGAGGCCCTCCTCTCCGGG - Intronic
932298042 2:70643073-70643095 CCCTGGAGGGCTTTCTCTCCTGG - Intronic
932336330 2:70933285-70933307 GGCTGCAGCCCCTCCTCTCCGGG - Exonic
932743693 2:74313542-74313564 TTCTGGATCCCATTCTCTCCTGG + Intronic
937080401 2:119136247-119136269 CTCTGGCCCACTCCCTCTCCAGG + Intergenic
937287545 2:120762739-120762761 CTCTGCAGGCCTTCCTTTCATGG - Intronic
937839601 2:126512120-126512142 CTCTGGAAGCTTTCATCTCCTGG + Intergenic
937993860 2:127679044-127679066 CCCTGGAGCTCTTTCCCTCCGGG - Intronic
938000109 2:127726973-127726995 CACAGGAGCCAGTCCTCTCCTGG + Intronic
938241822 2:129748134-129748156 ATCTGGAACCCACCCTCTCCTGG + Intergenic
941007531 2:160263087-160263109 CTCTGCAACTCTCCCTCTCCTGG - Intronic
941199471 2:162491151-162491173 CTGTGGAGCCTTTCCTCCTCTGG + Intronic
942786146 2:179705182-179705204 CTCTGAAGGCATTGCTCTCCTGG + Intronic
945170896 2:206993915-206993937 CTCTGCAGCCAATCCTTTCCAGG + Intergenic
945287425 2:208096488-208096510 CTCTGCAGCCCTTCACATCCTGG + Intergenic
946153938 2:217794610-217794632 CCCTGAAGCTCTTCTTCTCCAGG + Intergenic
946229508 2:218282744-218282766 CCCTGGATCCCTTCCTCCTCGGG - Intronic
947392171 2:229650796-229650818 CTCTGAATCTCTTCCTCTCCAGG + Intronic
948295648 2:236858335-236858357 CACTGCAACCTTTCCTCTCCAGG + Intergenic
948445738 2:238031331-238031353 CTCTGGAGCCTCTCCTCCCAGGG + Intronic
948661702 2:239511080-239511102 CTTTGCAGCTCCTCCTCTCCAGG + Intergenic
948802014 2:240437285-240437307 CTCTGGACCCCTGCCCCTCCAGG + Intronic
949047340 2:241877946-241877968 CTCTGCTCCCCTCCCTCTCCTGG + Intergenic
1169021586 20:2334932-2334954 CTCTGGAGCCCACCCTGACCGGG + Intronic
1169146953 20:3259004-3259026 CTCTGGAGCCCTTGCTGTCCTGG - Intronic
1171346384 20:24469442-24469464 CCCCGCACCCCTTCCTCTCCCGG + Exonic
1171382919 20:24746631-24746653 CTCTGGAGCACAACCTCCCCGGG - Intergenic
1171395284 20:24829184-24829206 CTCTGGGGCCCTGCATCACCTGG - Intergenic
1172843047 20:37913594-37913616 CTCTAGAGACCTCCCTCTCTTGG - Intronic
1173136400 20:40443012-40443034 CTTTGAACCCCATCCTCTCCTGG - Intergenic
1173165200 20:40682968-40682990 CTCGGCAGCCCTTCCCCGCCAGG + Intergenic
1173231621 20:41203248-41203270 CTCTGGAGCCCTTCAAGTTCCGG + Exonic
1174693758 20:52536593-52536615 CTTTGGAGAGCTTCTTCTCCTGG - Intergenic
1175392359 20:58635456-58635478 GTCTGGAGCCGTTTCTCTCTAGG + Intergenic
1175394953 20:58651392-58651414 CTCCTGACCCCTTCCTTTCCTGG - Exonic
1175610502 20:60347393-60347415 CTCTGGACCCCTCCCTTCCCTGG - Intergenic
1175610771 20:60349362-60349384 CTCTGCAGGCCTTCCTGTTCTGG + Intergenic
1176073673 20:63239044-63239066 CTCTGCAGCCCCTCCACTCCCGG + Intronic
1176098978 20:63356424-63356446 CACTGGCCCCCTTCCTCTCTCGG - Intronic
1176206456 20:63891251-63891273 CTGAGCAGCCCTTCCCCTCCCGG - Exonic
1179899246 21:44380415-44380437 CCCTGGAGCCCTCTCTCTGCTGG + Intronic
1179920781 21:44506250-44506272 CCCTGGATCCTTTCCTCCCCAGG + Intronic
1180147681 21:45930350-45930372 CCCTGGAGGCTTTTCTCTCCAGG + Intronic
1180979095 22:19870341-19870363 TTCTGGAGCCCTGCTTGTCCTGG - Intergenic
1181003571 22:19999144-19999166 CCCTGGAGCCCCTCCTGTACTGG + Intronic
1181007737 22:20021929-20021951 CTCAGGCCCCCTTCCTCTTCAGG + Intronic
1182125843 22:27815413-27815435 CCCTGACTCCCTTCCTCTCCAGG - Intergenic
1182283440 22:29231119-29231141 CCCTGGAGGCCTCCATCTCCGGG - Exonic
1182743168 22:32583514-32583536 CTCTGGAGTCTTACCTCCCCTGG + Intronic
1183310037 22:37104591-37104613 GTCTGGAGCCTTTGCTCTCCCGG - Intronic
1184089181 22:42283508-42283530 CCCTCGGGCCCCTCCTCTCCCGG + Intronic
1184189586 22:42885863-42885885 CTGTGGAGCTCTTTCTCTGCTGG - Intronic
1184522138 22:45001065-45001087 CTATGGGGCCCTTGCTCTTCCGG + Intronic
1185089239 22:48756658-48756680 CTCTGCATCCCTGCGTCTCCAGG - Intronic
950089943 3:10288323-10288345 CTCTGCAGCCACTCCTCTTCTGG + Intronic
950322335 3:12068500-12068522 CTCTGGAGCCCTTTCAGTCTGGG + Intronic
950863630 3:16171907-16171929 CACTGAAGCCCTGCCTCTGCTGG - Intergenic
950970640 3:17183596-17183618 CTCTTGAGCCCTTTCCCTGCAGG + Intronic
951194045 3:19804189-19804211 ATCTGGAGCTCTGACTCTCCTGG + Intergenic
951981864 3:28575547-28575569 CCCTGGTCCCCTCCCTCTCCCGG - Intergenic
953561979 3:43998953-43998975 CGTGGGAGCCTTTCCTCTCCGGG + Intergenic
954296743 3:49678615-49678637 CTCTTGAGCTCTGCCTCTCTGGG + Intronic
954406455 3:50347993-50348015 CTCTGTAGCCCATCATCTCCAGG + Intronic
954617633 3:51977761-51977783 GGCTGGAGCTCTTCCTCTGCTGG + Intronic
956655047 3:71541378-71541400 ATCTTGAGCCCTTTCTTTCCTGG + Intronic
957154620 3:76532054-76532076 CTCTTACGCCCTGCCTCTCCTGG + Intronic
958854159 3:99364376-99364398 ATCCAGAGCCCTTGCTCTCCTGG - Intergenic
959989643 3:112616709-112616731 CCCTGGAGAACTTCCTATCCAGG - Exonic
960622108 3:119647161-119647183 CTCTGGAGGCCTTCCTCACTGGG + Intronic
960637370 3:119796685-119796707 CTCTGGAGGGCATGCTCTCCTGG + Intronic
961013328 3:123449568-123449590 CTCTGGATGCCTTACTCCCCGGG - Exonic
962006062 3:131351338-131351360 CTCTGGAGTTCTTGCTCTCTAGG - Intergenic
962266037 3:133944987-133945009 GTGTGGAGCCCTGCCTATCCTGG + Intronic
962318029 3:134370914-134370936 CCCGGGCGCCGTTCCTCTCCAGG + Exonic
963983643 3:151567646-151567668 CTGTGGGACCCTTCCACTCCAGG + Intergenic
965667652 3:171112300-171112322 CTGTTGACCCCTTCCTCTCAAGG - Intronic
968463475 4:737567-737589 CTCTGCAGCCCCTGCTCTCCTGG + Intronic
968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG + Intronic
968873069 4:3251191-3251213 CTCTGCGTCCCTTCCTCACCAGG - Intronic
969064344 4:4466521-4466543 CTCTTTGTCCCTTCCTCTCCTGG - Intronic
969149795 4:5159943-5159965 CGCAGAAACCCTTCCTCTCCTGG + Intronic
969283895 4:6190572-6190594 CTCAGCAGACCTTCCTCCCCAGG - Intronic
969569830 4:8001802-8001824 CCCTGGCCCACTTCCTCTCCTGG + Intronic
971618784 4:28828228-28828250 GTCTGGAGCCCTTCCTGGCGGGG - Intergenic
977014930 4:91680289-91680311 CCTTATAGCCCTTCCTCTCCTGG + Intergenic
978220355 4:106265504-106265526 CTCTGGATCTCTCTCTCTCCTGG - Intronic
979299436 4:119069719-119069741 ATCTGGTGCCCCTCTTCTCCTGG - Intergenic
979494545 4:121369413-121369435 TTCTAGAGCCCTTTCTTTCCAGG - Intronic
984171750 4:176368176-176368198 ATCTGGAGCACTCACTCTCCTGG - Intergenic
984499338 4:180538510-180538532 CTGAGCAGACCTTCCTCTCCTGG - Intergenic
987241206 5:16001700-16001722 TTCTCCAGCCCTTCCACTCCTGG + Intergenic
987572869 5:19687615-19687637 CACTGGAGCCCTGCCACTGCTGG - Intronic
988145910 5:27308029-27308051 CTCTGGATGCTTTCCTCTACAGG - Intergenic
990188461 5:53232145-53232167 CTATGGAGCTCTTCCACTCAGGG - Intergenic
990967527 5:61465043-61465065 CCCTGCAGCCCTTCCTCTCTAGG - Intronic
990987980 5:61658854-61658876 CTCTGGGGCCCCCCTTCTCCTGG - Intronic
991052695 5:62290043-62290065 CTCAGGGGGCTTTCCTCTCCTGG + Intergenic
992382893 5:76256057-76256079 CTCTGCAGCCCTTGCTCTCAAGG + Intronic
993305621 5:86271783-86271805 CTCTGGTCCTGTTCCTCTCCTGG + Intergenic
993564581 5:89457507-89457529 CCCTGTTGCTCTTCCTCTCCTGG - Intergenic
994639711 5:102391658-102391680 CTCTGGTATCCTTCCACTCCAGG - Intronic
996188902 5:120514228-120514250 CTCTGGAAACCTTGCTCTCAAGG + Intronic
998154557 5:139777160-139777182 CTTTTCAGCCCTTCATCTCCTGG + Intergenic
998401468 5:141850970-141850992 CTCTGGAGCCATTTCTTCCCTGG - Intergenic
999329239 5:150661505-150661527 CTGCAGGGCCCTTCCTCTCCGGG - Intronic
999591162 5:153148195-153148217 ATCTGGAGCACATCGTCTCCTGG + Intergenic
1000589706 5:163143939-163143961 ATCTGGAGCACTCACTCTCCTGG - Intergenic
1002089005 5:176793457-176793479 TTCCAGAGCCCTCCCTCTCCCGG - Intergenic
1002576007 5:180174070-180174092 CTCTGGTGCCCACCGTCTCCAGG - Intronic
1002872379 6:1178524-1178546 CTTTGGAGACCTTGCTATCCTGG + Intergenic
1003121051 6:3319247-3319269 CCCTGCTGACCTTCCTCTCCCGG + Intronic
1003162992 6:3651879-3651901 CTCTGCACCCCTTCCTCTTTGGG - Intergenic
1003387396 6:5681800-5681822 CTCTGGATCCCTCCCTCTTTTGG + Intronic
1004057128 6:12150958-12150980 CTCGGGAGCCCCTTCTCTCAGGG + Intronic
1005363688 6:25056260-25056282 CTTGGGTGCCCTTCCTCTTCAGG + Intergenic
1005917207 6:30363635-30363657 CTCTGCATCCCTTCCACTGCAGG + Intergenic
1006288087 6:33113416-33113438 CTCTGCAGTCCTTCCTCTCAGGG - Intergenic
1012439944 6:99253512-99253534 CTCTCCAGCCCTGCCCCTCCAGG + Intergenic
1012676079 6:102114912-102114934 ATCTGGAGCACTCACTCTCCTGG - Intergenic
1014286417 6:119503705-119503727 CTCTGCTGCCCTAACTCTCCTGG - Intergenic
1015355810 6:132275713-132275735 CTCTGTGATCCTTCCTCTCCAGG + Intergenic
1017817054 6:158023424-158023446 GTGTGGAGCGCTGCCTCTCCGGG - Intronic
1019032062 6:169022326-169022348 CTCAGAAGCCCCTCATCTCCTGG + Intergenic
1019847437 7:3520143-3520165 CTCTGGAGCCCTTCCTCTGGGGG + Intronic
1020115388 7:5473314-5473336 CCCTGGAGCCCACCCTCTGCCGG + Intronic
1021189467 7:17603078-17603100 ATCTGGAGCACTCACTCTCCTGG + Intergenic
1022726551 7:32986760-32986782 CTCGGCAGTCCTTCTTCTCCGGG + Intronic
1022837221 7:34129804-34129826 GTCTGGAGTCTTTCCTCACCTGG + Intronic
1022869148 7:34457659-34457681 CTCTAGATTCCTTCCTCTCTGGG + Intergenic
1022883172 7:34612147-34612169 TTCTGGTGTCCTTCCTCTACTGG - Intergenic
1023548119 7:41340349-41340371 CTCTGAAGGCCTTCCACTACAGG + Intergenic
1023967050 7:44968154-44968176 CTCAGGAGACATTTCTCTCCTGG + Intronic
1024048275 7:45600085-45600107 CTCAGGGACCTTTCCTCTCCCGG - Intronic
1024653882 7:51432548-51432570 CTCTCCAGCCATCCCTCTCCAGG + Intergenic
1025994736 7:66520705-66520727 CTATGGTGTCCCTCCTCTCCGGG + Intergenic
1026793992 7:73354187-73354209 GTCTGGAGCCCACCCTTTCCAGG - Intronic
1026817113 7:73521829-73521851 CTCAGGAGGCCTTCCGCACCCGG - Exonic
1028431276 7:90749668-90749690 ATCTGGAGCACTTACACTCCTGG + Intronic
1029113159 7:98223643-98223665 CCCTGCAGCCCTGCCTCACCTGG + Exonic
1029201768 7:98843940-98843962 GTCTGGAACCCTTGGTCTCCAGG - Intergenic
1029933289 7:104396375-104396397 CTCTGGAGACCTTCATCTCTGGG - Intronic
1032012912 7:128358741-128358763 GGCTGGAGAGCTTCCTCTCCAGG + Exonic
1033661458 7:143405917-143405939 CTCTGGAACCCCTTCTCTCAGGG - Intronic
1034113078 7:148557393-148557415 ATCTGGAGCACCTACTCTCCTGG - Intergenic
1034487211 7:151373568-151373590 CCCTGGAGTCCTTGCTCCCCAGG + Intronic
1037162257 8:15788062-15788084 CTCTGTAGTCCTTCCTTTCATGG + Intergenic
1037711252 8:21357153-21357175 CTCTGGAGCCCTTCCATTTGTGG + Intergenic
1038777601 8:30544959-30544981 CTCTGCAGCCCTTCCACACAAGG - Intronic
1040543631 8:48380595-48380617 CCCTGGAAGCCGTCCTCTCCCGG - Intergenic
1040701446 8:50070976-50070998 CTTTGGAGCCCTAACTTTCCAGG - Intronic
1041290839 8:56307038-56307060 CTCTGCAGCCCTTCTTGTGCTGG - Intronic
1041777919 8:61544537-61544559 CTCTCTAGGCCTTCCTCTCCTGG + Intronic
1044955600 8:97476413-97476435 ATCTGAAGCCCTGACTCTCCTGG + Intergenic
1044997621 8:97852190-97852212 ATCTGGTGCCCCTCTTCTCCTGG + Exonic
1045860480 8:106810889-106810911 CTCTGGCACCCTTCCTCCCAGGG - Intergenic
1046606315 8:116375379-116375401 GTTTGGAGCACTTCCTCACCTGG - Intergenic
1046646554 8:116792171-116792193 CTCTGTACCTCTTCCTCTGCAGG - Intronic
1047615309 8:126558118-126558140 CTCGGCAGTCCCTCCTCTCCCGG + Exonic
1048253696 8:132888392-132888414 TCCTGGAGCCCTACCTCTTCTGG + Exonic
1049061419 8:140278931-140278953 CTCTGAAGGCCTGCCTCTTCTGG + Intronic
1049161134 8:141098670-141098692 CTCTGGTGTCCTTCCTGTCCTGG - Intergenic
1049383032 8:142326714-142326736 CTGTGCAGCCCATGCTCTCCAGG - Intronic
1049483951 8:142841734-142841756 CTCTGGTGCCCTCTCTCCCCAGG + Intronic
1049485686 8:142858809-142858831 CACAGAGGCCCTTCCTCTCCAGG - Intronic
1050260800 9:3838825-3838847 TTGTGGAGCCCTTGCTCTCTGGG + Intronic
1050560465 9:6829698-6829720 CTCTGGAGCTCTTCTTGTCTTGG + Intronic
1052340712 9:27361823-27361845 CTCTGAAGCCCTTCCTTTCTGGG + Intronic
1052819711 9:33129127-33129149 CTGTGGAGCCTTCCCTCTGCAGG + Intronic
1053428975 9:38029261-38029283 CTATGGGGCCATTTCTCTCCAGG + Intronic
1056715378 9:89024207-89024229 CCTTGAAGCCCTTTCTCTCCTGG + Intronic
1057301924 9:93891503-93891525 CTCTGGGGCCCTTGCACTCTGGG - Intergenic
1058700964 9:107599848-107599870 CACTGTGGCCCTTCCTGTCCTGG + Intergenic
1058901758 9:109448192-109448214 CTCTGAAGACCCTCCTCTCCAGG + Intronic
1059446372 9:114340738-114340760 CTCGGCTGCCCTGCCTCTCCTGG + Intronic
1060268631 9:122126561-122126583 CTCTGTCTCCCTTCCCCTCCCGG - Intergenic
1060810692 9:126610210-126610232 CTCTGCAGCCCTGGTTCTCCGGG + Intergenic
1061204465 9:129155027-129155049 CTCTGGGAGGCTTCCTCTCCTGG + Intergenic
1061478765 9:130886052-130886074 CTCTGGAGCCCCTCCTCCCCCGG + Intronic
1061935991 9:133857905-133857927 CTCTGCAGGCCCTCCTCCCCGGG - Intronic
1062502041 9:136855814-136855836 CACTGGACCCCTGGCTCTCCTGG - Exonic
1203771949 EBV:53990-54012 CTCTGGAGGCCGTCCTCTCCAGG - Intergenic
1185470456 X:378602-378624 CGCTGGAGCCTGTCCTCTCAGGG - Intronic
1185829096 X:3281691-3281713 CTTGGGAGCCCTTCCTCTCAGGG + Intronic
1187225590 X:17373347-17373369 CCCTTGAACCCTTTCTCTCCTGG + Intergenic
1187299017 X:18030077-18030099 CTCTCTTGTCCTTCCTCTCCTGG - Intergenic
1187529128 X:20080682-20080704 CTCTGGAGCCCCTGCTCCCAGGG - Intronic
1188988629 X:36790441-36790463 CTCGGGACCCCTTCCTCTGCAGG + Intergenic
1189185204 X:39048910-39048932 GTCATGAGCACTTCCTCTCCTGG - Intergenic
1192047366 X:67690055-67690077 CTGTTGATTCCTTCCTCTCCTGG + Intronic
1192811392 X:74550228-74550250 ACTTGAAGCCCTTCCTCTCCTGG + Intergenic
1193712358 X:84894713-84894735 CTGGGGATCCCTTCCTCCCCCGG + Intergenic
1195259968 X:103122364-103122386 TTCAGGATCCCTTCCTCTCAGGG + Intergenic
1195329658 X:103786633-103786655 CTCTGGAACCCCTCCCCTTCTGG - Exonic
1196968669 X:121085455-121085477 CTCTGGAGCCCATCCCTTCTGGG - Intergenic
1197167903 X:123398718-123398740 GTCTCCAGCACTTCCTCTCCGGG - Exonic
1198049099 X:132931281-132931303 TTCTGGAGGCCTTGGTCTCCTGG - Intronic
1201249193 Y:12039204-12039226 CTTGGGAGCCCTTCCACTCAGGG - Intergenic