ID: 907988493

View in Genome Browser
Species Human (GRCh38)
Location 1:59556077-59556099
Sequence GAGAGATCTGCAGAGGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 438}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907988487_907988493 7 Left 907988487 1:59556047-59556069 CCTTTTGTAAGGCTCAGCTGTCC No data
Right 907988493 1:59556077-59556099 GAGAGATCTGCAGAGGCCTGAGG 0: 1
1: 0
2: 5
3: 33
4: 438
907988486_907988493 8 Left 907988486 1:59556046-59556068 CCCTTTTGTAAGGCTCAGCTGTC No data
Right 907988493 1:59556077-59556099 GAGAGATCTGCAGAGGCCTGAGG 0: 1
1: 0
2: 5
3: 33
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907988493 Original CRISPR GAGAGATCTGCAGAGGCCTG AGG Intronic
901231058 1:7641960-7641982 CAGAGTCCTGCAGAGGCCGGGGG - Intronic
901940083 1:12655395-12655417 CTGAGAACTGAAGAGGCCTGAGG - Intronic
903186259 1:21631010-21631032 GGGTGGTCTGCAGAGGCCAGAGG - Intronic
903262634 1:22139641-22139663 GAACGATCTGCTGAGGACTGTGG + Intronic
903332180 1:22601833-22601855 GAGAGGAGGGCAGAGGCCTGGGG - Exonic
903609112 1:24597097-24597119 GGCAGACCTACAGAGGCCTGAGG + Intronic
905041582 1:34964339-34964361 GAGAGAGCTGCAGAGTCCCCAGG + Intergenic
905118973 1:35667117-35667139 GAGAGCTCTGGAGAGGGCAGAGG - Intergenic
905171965 1:36114910-36114932 CAGAGATGGGCAGAGGCCAGGGG - Intronic
905173581 1:36123271-36123293 GAGAGTTCTGGAGCGGGCTGGGG + Intronic
905272522 1:36796256-36796278 CAGAGATCTGCAGCCTCCTGGGG + Exonic
905352648 1:37358315-37358337 GAGAAAACAGCAGAGGCATGGGG + Intergenic
906516422 1:46441661-46441683 GAGTGAACTGCAGAGACATGAGG - Intergenic
906792302 1:48669653-48669675 GAGATATCTGGAGAGGCTTTGGG - Intronic
907469707 1:54665330-54665352 GAGAGCTGGGCAGAGGCATGGGG - Intronic
907490228 1:54804683-54804705 GAGACCTTTACAGAGGCCTGAGG - Intergenic
907988493 1:59556077-59556099 GAGAGATCTGCAGAGGCCTGAGG + Intronic
908176732 1:61563230-61563252 GAGAAAGGTGTAGAGGCCTGAGG + Intergenic
908246067 1:62228574-62228596 GAGAGGTCTGGAAAGGGCTGCGG - Intergenic
909330552 1:74404673-74404695 GGGAGATCAGCATAGGCCAGAGG - Intronic
909442025 1:75707540-75707562 GAAGGTTCTGCAGAGCCCTGGGG - Intergenic
915520591 1:156440114-156440136 GAGAGACCTCCAGAGCCCCGGGG - Intergenic
915584708 1:156838143-156838165 GAGAGAGGCCCAGAGGCCTGGGG - Intronic
917222803 1:172749417-172749439 TAGAGTTCTGCAGAGGGCTCGGG - Intergenic
917505799 1:175625818-175625840 GGGAGATGTGCAGATGGCTGGGG - Intronic
917968639 1:180193866-180193888 GAGAGGTCAGCAGGGGCCAGAGG - Intronic
917981420 1:180271955-180271977 GAGAGCTCTGCAGAGGACTGTGG + Exonic
918513655 1:185338912-185338934 GAGAAGTCTGCAGCGGCCTGTGG - Intergenic
918842220 1:189556409-189556431 GAGGTATCTGCTGAGTCCTGAGG - Intergenic
919712827 1:200745292-200745314 GAGACATCTGGAGATGTCTGGGG - Intronic
920087657 1:203429496-203429518 GAAGGTTCTGCAGAGCCCTGGGG - Intergenic
920376672 1:205512510-205512532 ATGAGATGTTCAGAGGCCTGGGG + Intronic
920847561 1:209606764-209606786 CAGAGATCAGCAGAGAGCTGAGG + Intronic
921069888 1:211649964-211649986 CACAGATCTGGGGAGGCCTGGGG - Intergenic
921709379 1:218358173-218358195 GAGAGATTTGCAAAGACCAGTGG - Intronic
921993806 1:221395912-221395934 GAGAGCTCTGAAGAGGCCCCGGG + Intergenic
922704259 1:227780742-227780764 GCCAGGGCTGCAGAGGCCTGTGG + Exonic
924300959 1:242637253-242637275 GAGATAACTGCACATGCCTGAGG - Intergenic
1062789364 10:291874-291896 GAGGGAGATGCAGAGGTCTGTGG + Intronic
1063096841 10:2915840-2915862 GAGAGAGCTGGAGAGGCCATTGG - Intergenic
1064924483 10:20555266-20555288 GAGACATCTTCAGAGTCCTGGGG - Intergenic
1065997664 10:31074499-31074521 GAGAGCTCTGCAGAGGAGAGGGG + Intergenic
1066262009 10:33738293-33738315 GGGAGGGCTGCAGAGGCCTCCGG - Intergenic
1066494653 10:35930944-35930966 GAGAGATATGCAGAGCCCAATGG + Intergenic
1067681390 10:48443649-48443671 GAGGGCTCTGCAGGGGCCTGGGG + Intergenic
1067858675 10:49821087-49821109 GGGAGTTCTGCAGTGGCCAGTGG - Intronic
1069782573 10:70966026-70966048 TAGTGCTCTGCAGAGCCCTGGGG + Intergenic
1070551978 10:77497041-77497063 CAGACCTCTGCAGAGGCCTTGGG - Intronic
1070709110 10:78664942-78664964 GAGAGATATGCTAAGGTCTGTGG - Intergenic
1070917459 10:80164004-80164026 CAGGGATCTGCAGAGGGCAGAGG + Intronic
1071833739 10:89398156-89398178 GAAGGTTCTGCAGAGCCCTGGGG + Intronic
1072190231 10:93072243-93072265 GAAATATCTGCAGAGGTCGGAGG - Intergenic
1073087365 10:100901637-100901659 GAGTGACCTGGAGAGGACTGGGG + Intergenic
1073520429 10:104123033-104123055 GATGGATTCGCAGAGGCCTGAGG - Exonic
1073944159 10:108730918-108730940 GTGAGATGTGCAGAGGACTTGGG + Intergenic
1074256754 10:111810749-111810771 GAGAGATGTGCAGCCACCTGGGG + Intergenic
1074384678 10:113007345-113007367 GAGCCAGCTCCAGAGGCCTGGGG - Intronic
1075772580 10:124952359-124952381 GAGAGAGTTGCAGGGCCCTGAGG + Intronic
1075965808 10:126610388-126610410 GGGAAAACTGCAGAGCCCTGGGG - Intronic
1076451033 10:130557117-130557139 GAGGACTCTGCAGAGTCCTGAGG - Intergenic
1076479909 10:130778093-130778115 CAGAGGTCTGCAGAGGCTGGGGG + Intergenic
1076497384 10:130905837-130905859 GGCAGAGCTGCAGAGACCTGAGG - Intergenic
1076501448 10:130939555-130939577 GAGAGGGGAGCAGAGGCCTGCGG + Intergenic
1076721573 10:132395634-132395656 GGGGCAGCTGCAGAGGCCTGTGG + Intergenic
1077068807 11:657843-657865 GAGAGACCGTCACAGGCCTGAGG + Intronic
1077118219 11:895009-895031 GACACAGCTGCAGAGGCGTGAGG - Intronic
1077457188 11:2688155-2688177 GAGCTGTCTGCAGAGGCCTAGGG - Intronic
1078934611 11:15940157-15940179 GTGAGATCAGGAGAGGCTTGGGG - Intergenic
1079112324 11:17611932-17611954 GGCAGATCTGCAGAGGTCTCAGG + Intronic
1079270659 11:18982830-18982852 GTGAGATGTGCAGAGGACTTGGG + Intergenic
1080851558 11:36074647-36074669 GAGTGATGTGCTGAGGCTTGAGG + Intronic
1081317023 11:41642110-41642132 GAAATATCTGCAGATGGCTGAGG - Intergenic
1084206041 11:67593575-67593597 GAAGGTTCTGCAGAGCCCTGGGG + Intergenic
1084589751 11:70083896-70083918 GAGAGACCTGCAGAGGCCAGAGG + Intronic
1084905442 11:72342681-72342703 GGGAAGACTGCAGAGGCCTGAGG - Intronic
1085332849 11:75667826-75667848 CAGAGATCTGCACGGGCTTGGGG + Exonic
1085415972 11:76319093-76319115 GAGCCATCTGGAGAGACCTGGGG - Intergenic
1085428513 11:76426159-76426181 GAGACGTCTGCAGAAGGCTGTGG - Intergenic
1086048231 11:82558462-82558484 GAGAGATCTGAAGAGTCTTCAGG + Intergenic
1086518261 11:87639880-87639902 AAGAAACCTGCAGAGGGCTGAGG - Intergenic
1086850574 11:91802761-91802783 GAGAGAGCTCAAGAGGCTTGTGG + Intergenic
1088923892 11:114281393-114281415 GAGAGATGTTCAGAGCACTGGGG + Intronic
1089340380 11:117753306-117753328 GTGAAAACAGCAGAGGCCTGGGG + Intronic
1089496986 11:118912957-118912979 GAGAGAGCTTCTGAGGACTGAGG - Intronic
1089519586 11:119055044-119055066 GTGAGAACTGCAGCTGCCTGAGG + Exonic
1090364403 11:126193508-126193530 GTGAGATGTGCAGAGACCTAAGG + Intergenic
1090606189 11:128425024-128425046 GAGAGCTCCACTGAGGCCTGTGG - Intergenic
1090893845 11:130951614-130951636 GAGAGAACTGCCCAGGTCTGGGG + Intergenic
1090972872 11:131657967-131657989 GTGAGCTCTGAAGAGACCTGAGG + Intronic
1091191632 11:133700317-133700339 GGGACCTCTGCAGAGTCCTGAGG - Intergenic
1091253538 11:134164150-134164172 CACAGGCCTGCAGAGGCCTGTGG + Intronic
1091312163 11:134582264-134582286 GAAAGAGATGCAGAGACCTGTGG + Intergenic
1092006777 12:5076795-5076817 AAGAGGGCTGCAGAGGGCTGAGG + Intergenic
1092231605 12:6778695-6778717 GAGAGAGCTGCGGAGGCAAGGGG - Intergenic
1093041091 12:14380431-14380453 GAGAGTTCTCCAGAGACCTTAGG + Intronic
1096444458 12:51676573-51676595 GAAAGAGGTGCATAGGCCTGGGG + Intronic
1101569182 12:105937339-105937361 TTGATATCTGCAGAGCCCTGGGG + Intergenic
1102454222 12:113061505-113061527 CTGAGACCTGGAGAGGCCTGAGG - Intronic
1103216714 12:119207366-119207388 GAGAGCCCTGTACAGGCCTGGGG + Intronic
1104909048 12:132230859-132230881 GGGAGCCCTGCAGTGGCCTGCGG - Intronic
1105314274 13:19243007-19243029 GGGATGTCTGCAGAGTCCTGTGG - Intergenic
1106136317 13:26976223-26976245 GAGAGCACTGCCGAGGGCTGTGG - Intergenic
1107189273 13:37560079-37560101 GTGAGATGTGCAGAGGACTTGGG + Intergenic
1110418670 13:75279903-75279925 GAAGGTTCTGCAGAGCCCTGCGG + Intergenic
1112579347 13:100664760-100664782 GTGAGATGTCCAGAGGCCTATGG - Intronic
1113609203 13:111631363-111631385 GGGACAGCTGCAGAGACCTGGGG + Intronic
1113609213 13:111631404-111631426 GGGACAGCTGCAGAGACCTGGGG + Intronic
1113609292 13:111631732-111631754 GGGACAGCTGCAGAGACCTGGGG + Intronic
1113850454 13:113414624-113414646 GGGAGATGTGCAGAGGCACGTGG - Intergenic
1115961129 14:38837111-38837133 GATGGCTCTGCAGTGGCCTGAGG - Intergenic
1117257053 14:53988688-53988710 GAAATCTCTGCAGAGTCCTGAGG + Intergenic
1117913126 14:60652988-60653010 GCGAGGTCTGAATAGGCCTGGGG + Intronic
1118327244 14:64789901-64789923 GAAAGAACCGCAGAGGCATGAGG + Intronic
1118590121 14:67394926-67394948 GAGTTCTCTGCAGAGTCCTGAGG - Intronic
1119207628 14:72806431-72806453 GAGAGATGAGCAGAGGACTAAGG - Intronic
1119485701 14:74985111-74985133 GACAGCTCTGCAGAGCCCAGTGG - Intergenic
1121689455 14:95865732-95865754 GGAAGATCTGCAGAACCCTGGGG + Intergenic
1122315051 14:100821067-100821089 CAGAGAACTGCAGAGGCCTGGGG - Intergenic
1122772519 14:104103716-104103738 GTGGGAGCTGCAGAGGGCTGGGG - Intronic
1123048037 14:105527900-105527922 GACAGAGGTGCAGGGGCCTGTGG + Intronic
1123205736 14:106711373-106711395 GAGAGCACTGCAGAGCCCCGTGG - Intergenic
1123632939 15:22274636-22274658 GAGAGGTTTGCAGGGCCCTGAGG - Intergenic
1123880618 15:24675575-24675597 GAGGGAACTGCTGGGGCCTGCGG - Intergenic
1124069192 15:26375751-26375773 GACACAGCTGCAGGGGCCTGTGG + Intergenic
1124079287 15:26476305-26476327 CAGGGGTCTTCAGAGGCCTGAGG + Intergenic
1124370822 15:29103791-29103813 GAGACAGAAGCAGAGGCCTGGGG + Intronic
1124886470 15:33692005-33692027 ATGTGATCTGCAGAGCCCTGGGG - Intronic
1125447130 15:39769963-39769985 AAGTGGTCTGCAGAGCCCTGGGG - Intronic
1127011170 15:54630708-54630730 GAGTGATCAGTGGAGGCCTGGGG - Exonic
1127487644 15:59434321-59434343 TAGAGATCTGTAGTGGCCAGTGG - Intronic
1128762016 15:70223516-70223538 GGGAGAGGTGCTGAGGCCTGAGG - Intergenic
1129236347 15:74225895-74225917 GCTAGTTCTGCAGAGTCCTGGGG + Intergenic
1129392364 15:75226711-75226733 CAAAGTTCTGCAGAGGTCTGAGG + Intergenic
1129702168 15:77774324-77774346 GAGAGGTGGGCAGAGGGCTGAGG - Intronic
1129936466 15:79454245-79454267 GAGGGATATGCAGAGACCAGTGG - Intronic
1130384960 15:83403145-83403167 GAGAGATGGGCAGATGCCTAGGG + Intergenic
1131222731 15:90598517-90598539 CACAGAACTGCAGAGGCTTGGGG + Intronic
1131718967 15:95146387-95146409 TACAGATCTGCAGTGACCTGGGG - Intergenic
1132009816 15:98266256-98266278 GAGGGCTCAGCAGAGACCTGCGG - Intergenic
1132478368 16:153686-153708 CCGGGAGCTGCAGAGGCCTGGGG + Intronic
1132480453 16:164276-164298 CCGGGAGCTGCAGAGGCCTGGGG + Intronic
1132645603 16:997958-997980 GAGAGCTCGCCAGAGGACTGTGG + Intergenic
1132678517 16:1130484-1130506 GAGAGGGATGCAGGGGCCTGAGG - Intergenic
1133045847 16:3087944-3087966 GGGAGACCTGCAGAGGGCTCAGG - Intergenic
1133258926 16:4536046-4536068 GAGAGCTCTGCAGAGGACCTTGG - Intronic
1133286144 16:4691818-4691840 GGGGGCTGTGCAGAGGCCTGGGG - Intergenic
1134047197 16:11109566-11109588 GGGGGAACTGCAGTGGCCTGTGG - Intronic
1134666398 16:16022117-16022139 GAGTGATCAGCCAAGGCCTGGGG + Intronic
1137264832 16:46860111-46860133 CAGAGAACTTCAGAGGCCTCAGG - Intergenic
1137614319 16:49837815-49837837 GAGGGAACTGCAGAGGACAGTGG - Intronic
1137887831 16:52125961-52125983 GAGAGATCAGCAGAGTCTGGAGG + Intergenic
1138336370 16:56256538-56256560 TAGAGAACTGCTGAGGCCTTTGG - Intronic
1138394829 16:56695812-56695834 CAGAGACCTGCAGAGACCTCAGG + Intronic
1138475226 16:57266646-57266668 GAGAGACCTGCAGGGCCCAGGGG - Intronic
1138829469 16:60359333-60359355 GAGGGATCCTCAGGGGCCTGAGG + Exonic
1139256559 16:65548435-65548457 GGGCAACCTGCAGAGGCCTGGGG + Intergenic
1139445021 16:66992339-66992361 GTGAGACCTGTAGAGACCTGGGG + Intronic
1139517343 16:67459751-67459773 GGAGGAACTGCAGAGGCCTGGGG - Intronic
1139564207 16:67763192-67763214 GAGAGGAGAGCAGAGGCCTGTGG + Intronic
1139917687 16:70438634-70438656 GAGAGCTCTTCCGAGGGCTGGGG + Intronic
1140429481 16:74889600-74889622 GAGAAAGGTGCAGAGGCCCGAGG - Intronic
1141778945 16:86143883-86143905 AAGAGAGATGCAGAGGCTTGAGG - Intergenic
1141990280 16:87605297-87605319 CAGACATCTCCAGAGTCCTGAGG + Intronic
1143037116 17:4005628-4005650 GAGGGATCTTCAGAGGCCACGGG + Exonic
1143474620 17:7195636-7195658 GAGACATCTGCAGAGCGCAGCGG + Intronic
1143651212 17:8265231-8265253 GAGAAATGTGGAGAGGCCAGGGG - Intronic
1143690687 17:8561928-8561950 GACAGGGCTGCAGGGGCCTGTGG + Intronic
1144656332 17:17039538-17039560 GAGAGAGCTGCAGAGGAGAGAGG - Intergenic
1145879561 17:28343466-28343488 GGGAGATCTGCAGAGGGTTTGGG + Intronic
1146352393 17:32105495-32105517 GAGAGATGTGCAGATACCTGAGG - Intergenic
1146666745 17:34710195-34710217 GAGTGGCCTGCAGGGGCCTGGGG + Intergenic
1146709518 17:35028809-35028831 TAGAGAAGTGAAGAGGCCTGAGG - Intronic
1146912889 17:36659549-36659571 AAGGGGTCTGCCGAGGCCTGGGG + Intergenic
1148576912 17:48718872-48718894 GACAAATCGGAAGAGGCCTGCGG - Intergenic
1148906790 17:50917417-50917439 GAGGAATCTGCAGAGGTCAGGGG + Intergenic
1149754779 17:59177678-59177700 AAGAGACCAGCAGAGTCCTGAGG + Intronic
1150893939 17:69187304-69187326 GAGATATCTGTACATGCCTGAGG + Intronic
1150988517 17:70227605-70227627 GAGAATTCTGCAGCGGCCAGCGG - Intergenic
1151032695 17:70759456-70759478 GAGCTCTCTGCAGAGTCCTGAGG + Intergenic
1151198798 17:72452625-72452647 GTGGGATCTGCAGGAGCCTGTGG + Intergenic
1151719957 17:75849368-75849390 GTGAAGTCTGCAGAAGCCTGCGG - Intronic
1152215831 17:79031955-79031977 GAGAGATTTGGACAGGCTTGTGG + Intronic
1152484574 17:80581932-80581954 GGGAGAGTTGCAGAGGGCTGGGG + Intronic
1152529188 17:80907023-80907045 GTGGGTTCTGCAGATGCCTGAGG - Intronic
1152880886 17:82814433-82814455 GGGAGATCTGAAGAGGCCCTGGG + Intronic
1153462830 18:5355420-5355442 GCCACATCTGCAGAGGGCTGAGG - Intergenic
1154149781 18:11897302-11897324 GAGAAAACTGCAGAGCCCTGGGG + Exonic
1155416421 18:25604671-25604693 GAGAAATCTGCAGCTGCTTGGGG + Intergenic
1155565159 18:27126517-27126539 GAGGCACCTGCAGAGGCCTAGGG + Intronic
1156229843 18:35142768-35142790 GGGGGATCTGCAGAGGCTGGAGG - Exonic
1156462159 18:37327227-37327249 CAGAGACCTGCAGAGGCTGGTGG - Intronic
1157004649 18:43567680-43567702 AAGAGATGTGCAGAGGTTTGGGG + Intergenic
1157124732 18:44945704-44945726 GATAGTTCTGCTGAGGGCTGAGG + Intronic
1157333684 18:46721634-46721656 GAGAGCACTGTAGAGGGCTGTGG - Intronic
1157514123 18:48298798-48298820 GATGGATCTGCAGAGCCCAGAGG - Intronic
1157514631 18:48302089-48302111 GAGAATTCTGCAGAAGCCAGAGG - Intronic
1157555248 18:48609238-48609260 GTGAGATCTGCAGAGATCTGGGG + Intronic
1157725067 18:49957935-49957957 GTGAGGACTGCAGAGTCCTGGGG - Intronic
1160036876 18:75309847-75309869 GGGAGACCGGCAGAGGCCGGAGG - Intergenic
1160452741 18:78977148-78977170 CAGAGATCTGGAGAGACTTGCGG - Intergenic
1161612750 19:5252084-5252106 GATTGATCTGAAAAGGCCTGGGG + Intronic
1161933417 19:7356174-7356196 GAGAGGTCACCTGAGGCCTGGGG - Intronic
1162080046 19:8212336-8212358 GAGAGATATGGAGAGGCCGGGGG + Intronic
1162157897 19:8692170-8692192 GAGAGATCAGCAGAGGATTCAGG + Intergenic
1162295597 19:9811252-9811274 CAGCTATCTGCAGAGGCTTGAGG - Exonic
1162370354 19:10275085-10275107 GGGGCACCTGCAGAGGCCTGGGG + Intronic
1162599538 19:11657322-11657344 GAAGGTTCTGCAGAGCCCTGGGG + Intergenic
1164572909 19:29386940-29386962 CAGGGATCTGCTGAGGGCTGTGG - Intergenic
1164607318 19:29609517-29609539 GAGAGAACTGCCCAGGTCTGTGG + Intronic
1164915370 19:32047614-32047636 TAGGGGTCTGCAGAGGCCTCGGG + Intergenic
1165058441 19:33193795-33193817 GGGAGATCTCCAGAGGCCTCTGG + Intronic
1166047605 19:40238635-40238657 GAGAGGTGTGGAGAGGGCTGTGG - Intronic
1166267293 19:41692131-41692153 GAGGGGTCTGGGGAGGCCTGAGG - Intronic
1166597056 19:44059342-44059364 GAGAGAGCTGGAGGGCCCTGTGG - Intronic
1166938957 19:46351538-46351560 TAGAGATCTGCAGAGCCGGGTGG + Intronic
1167609914 19:50502040-50502062 GAGGGCTCTGCAGAGGCTGGCGG - Intergenic
1167740654 19:51323154-51323176 GAGAGAGCTACAGAGACCTAGGG - Intronic
1167765537 19:51479793-51479815 GAGAGCTATGTAGAGGCCTGGGG + Intronic
1167775352 19:51551027-51551049 GTGAGGGCAGCAGAGGCCTGAGG - Intergenic
1167988784 19:53340385-53340407 GAGAGGTCTGCAGGGGCCATGGG - Intronic
1168132392 19:54329863-54329885 GTGAGATCTGCAGAGCCAGGAGG - Intergenic
1168168493 19:54571527-54571549 CAGAGAACGACAGAGGCCTGTGG + Intergenic
1168263773 19:55209928-55209950 GTGAGAGCTGCAGGGGCTTGTGG - Intergenic
1168324094 19:55529541-55529563 GAGGGACATGCAGAGGTCTGAGG + Intergenic
925523042 2:4768755-4768777 GCAAGACCTGAAGAGGCCTGAGG + Intergenic
925632518 2:5909182-5909204 GAGATATCTGCATAGTTCTGTGG + Intergenic
925650608 2:6085634-6085656 GATAGATTTGCAGAGACTTGAGG - Intergenic
926178509 2:10618392-10618414 CAGTGATCAGCAGAGGACTGTGG - Intronic
927423079 2:22953303-22953325 GAGAGGTCAGCAGGGGCCCGGGG - Intergenic
927475395 2:23410645-23410667 AAGAGGTCTGAAGAGGACTGCGG - Intronic
927491911 2:23526433-23526455 GAGGGCTCTGCAGGGGCCGGGGG + Intronic
927820459 2:26259564-26259586 GAAGGTTCTGCAGAGCCCTGGGG - Intronic
927890392 2:26744421-26744443 GGAAGAAGTGCAGAGGCCTGAGG + Intergenic
930019671 2:46993992-46994014 GAGAGAGCTGCCCATGCCTGTGG + Intronic
931594547 2:63927133-63927155 GAGAGCTCTGAAGAGAGCTGTGG + Intronic
932213056 2:69947869-69947891 GGGATATCCGCAGAGGCCAGAGG + Intergenic
932309468 2:70728190-70728212 GAGAGCACTGCAGTGGCCTCAGG - Intronic
932760467 2:74436244-74436266 CAGAGAGCTGCACTGGCCTGGGG + Intronic
933984787 2:87581514-87581536 CAGAGGTCTGCAGGGGGCTGGGG - Intergenic
934690727 2:96356779-96356801 GAGAGGTCTTCGGAGGCCTCTGG + Intronic
935580211 2:104750130-104750152 GAGGGACTTGCTGAGGCCTGTGG + Intergenic
936309065 2:111369297-111369319 CAGAGGTCTGCAGGGGGCTGGGG + Intergenic
936658138 2:114512003-114512025 TAAAGATCTGCAGATGCCTGTGG + Intronic
937321709 2:120964819-120964841 GAGAGGTCAGCAGAGGCCCAGGG - Intronic
937981244 2:127617136-127617158 GTGAGATGTGCAGAGGACTTGGG - Intronic
937983790 2:127629596-127629618 GAGGGCTCTGCAGGGGCCAGAGG - Intronic
938073352 2:128319463-128319485 GGGCTGTCTGCAGAGGCCTGCGG + Intergenic
938099720 2:128490491-128490513 GAGGGTTCTGCAGAGGCAGGCGG + Intergenic
938169772 2:129064719-129064741 GAAGGATCTGCAGAGCACTGGGG + Intergenic
938206497 2:129428742-129428764 GGGAGGTGTGCTGAGGCCTGGGG - Intergenic
940101402 2:150043279-150043301 AAGAGGTCTGGAGTGGCCTGAGG - Intergenic
940548747 2:155124516-155124538 CAGAGATCTCCAGAGACTTGTGG + Intergenic
944446654 2:199798640-199798662 GAGAGATCAGAAGGGCCCTGAGG + Intronic
946193690 2:218021164-218021186 GAGAGCTCTGCACAGCCCTTGGG + Intergenic
946300451 2:218820824-218820846 GAGAGGCCCGCAGAGGTCTGAGG + Intergenic
948040266 2:234896097-234896119 GAGAGAGGCACAGAGGCCTGAGG + Intergenic
948252681 2:236543216-236543238 GAGAGATCCCCAGAGGCAAGTGG - Intergenic
948292296 2:236834811-236834833 GAGAGATTTGGAGAGGTCTGTGG - Intergenic
948304412 2:236935966-236935988 CAGACACCTGCAAAGGCCTGAGG + Intergenic
948476071 2:238220865-238220887 CAGAGACCTGCAGAGACCTTGGG - Intergenic
1169619780 20:7492358-7492380 GAGAACTCTGCAGAGGCCCAAGG + Intergenic
1170075646 20:12415806-12415828 GCTAGATTTGCAGAGGCTTGAGG - Intergenic
1170123250 20:12934733-12934755 GAGATAACTGCACAGGCCTAAGG + Intergenic
1170124564 20:12949132-12949154 GAGATAACTGCACATGCCTGAGG + Intergenic
1170213199 20:13865980-13866002 GAGAGGTGTGCAGAGCCCTAGGG + Intronic
1170446445 20:16432655-16432677 TAAATATCTGCAGAGGCCTGAGG - Intronic
1170543422 20:17411642-17411664 GACAGATCTGAAGAGGGCAGTGG + Intronic
1170589858 20:17763610-17763632 GAGAGAATTGCAGGGGCATGGGG - Intergenic
1171344662 20:24456927-24456949 CAGAGAGCTGCAAGGGCCTGTGG - Intergenic
1172134978 20:32680820-32680842 GAGAGCTCTGCAAAGGCCCCAGG + Intergenic
1173009209 20:39166206-39166228 GAGAGAAGAGCAGAGGCCAGTGG - Intergenic
1173670594 20:44796132-44796154 GACAGCTCAGCAGAGACCTGAGG - Intronic
1174115688 20:48224990-48225012 GAGAGGACTGCAGTGGCATGGGG + Intergenic
1175790218 20:61736076-61736098 CAGAGATCTGCACAGGAGTGGGG - Intronic
1176133521 20:63507780-63507802 GAAAAAGCTGCAGAGGCCAGGGG - Intergenic
1176265381 20:64206493-64206515 GGCAGATCTGTAGAGACCTGGGG + Intronic
1176299138 21:5090383-5090405 GAGAGCAAAGCAGAGGCCTGAGG - Intergenic
1177744173 21:25190994-25191016 AAAAGATCTGCATATGCCTGTGG - Intergenic
1178316138 21:31568283-31568305 CAGGGAGCAGCAGAGGCCTGTGG - Intergenic
1178994221 21:37383139-37383161 CAGTGATCTGCAGAGGCAGGCGG + Intronic
1179542375 21:42091880-42091902 GAGAGAAGGGAAGAGGCCTGGGG + Intronic
1179654808 21:42838250-42838272 GTGAGATGTGCAGCGGGCTGTGG - Intergenic
1179835054 21:44025800-44025822 GAGAGAGCAGCAGAGGGCAGGGG + Intronic
1179857888 21:44171565-44171587 GAGAGCAAAGCAGAGGCCTGAGG + Intergenic
1180225178 21:46387869-46387891 GCGAGATGTGGAGGGGCCTGTGG + Intronic
1180595855 22:16972794-16972816 GAGAGAGCTGGAGAGGCCCTGGG - Intronic
1181024129 22:20117863-20117885 GCAGGCTCTGCAGAGGCCTGGGG + Intronic
1181167963 22:20993379-20993401 CAGAGCTCTGCTGAGGCCTGGGG + Intronic
1181301812 22:21885711-21885733 GAGAAAACTGCAGAGCCCTGGGG + Intergenic
1181544601 22:23594812-23594834 CAGAGATCCTCAGAGGGCTGTGG + Intergenic
1181731444 22:24849821-24849843 GAGATACGTGCAGATGCCTGAGG - Intronic
1181812091 22:25409542-25409564 GAGAGGTCTGCAGGGGCCTGAGG - Intergenic
1182114742 22:27749732-27749754 CAGGGATCTGCAGACTCCTGAGG - Exonic
1183389692 22:37538506-37538528 GAGAGACCTGCAGACCCCTGAGG - Intergenic
1185022846 22:48390141-48390163 GACAGAACTGCACTGGCCTGTGG + Intergenic
1185063689 22:48620298-48620320 GAGAGGTTTGCAGGGCCCTGAGG - Intronic
950454877 3:13086704-13086726 GAGAGCTGTGCAGAGAGCTGAGG - Intergenic
950553982 3:13684333-13684355 GAGAGTCCTGCAGAAGCCTCCGG + Intergenic
950675108 3:14550024-14550046 GAAAGATCAGCAGAGGTATGGGG + Intergenic
950889244 3:16388178-16388200 GAGGGATCTGCAAAGTGCTGAGG - Intronic
951078944 3:18428200-18428222 GAGTTCTCTGCAGAGTCCTGTGG + Intronic
951224586 3:20106787-20106809 GAGAGATCTGCAAACGTCTAAGG - Intronic
952106954 3:30081944-30081966 GAAAGTTTTGCAGAGCCCTGGGG + Intergenic
952192723 3:31041302-31041324 GAGAAATCTGCAGTTCCCTGAGG - Intergenic
952366945 3:32683441-32683463 GAGAGATGGGAAGAGGCATGAGG + Intergenic
952746338 3:36785056-36785078 GAAAGATCTCTTGAGGCCTGAGG - Intergenic
952853737 3:37750696-37750718 GACATATCTGGAGAGGCCAGGGG + Intronic
952933213 3:38375703-38375725 GACAGGTCTCCAAAGGCCTGTGG - Intronic
953093145 3:39749544-39749566 GAGACATCAGCTGAGGACTGGGG - Intergenic
953669681 3:44952060-44952082 GAGAGATCTGCAGATTCAAGAGG - Intronic
954365304 3:50142887-50142909 GTGAGGTCTGAAGAGCCCTGTGG + Intergenic
954460171 3:50621985-50622007 GAGACCTCTGCAGAGTCCTCTGG + Intronic
955468024 3:59256404-59256426 GAGAGGTCTCCAGAGGAATGTGG - Intergenic
956363481 3:68473646-68473668 CAGACAACTGCAGAGACCTGAGG - Intronic
956935907 3:74101693-74101715 GAGATGTCTGCACCGGCCTGAGG - Intergenic
958491422 3:94778927-94778949 TAGAGACCTGCAGAGGCAAGAGG - Intergenic
959944753 3:112114853-112114875 GGGAGATGGGCAGAGGTCTGAGG + Intronic
960505576 3:118489287-118489309 GAGAGCTCTGGAAAGGCCTTGGG + Intergenic
962455954 3:135565844-135565866 GTAAGATCTGCAGAGGCATCTGG - Intergenic
963344284 3:144075290-144075312 GAGGACTCTGCAGAGTCCTGAGG - Intergenic
964481779 3:157145880-157145902 AAGAAATATGGAGAGGCCTGTGG + Intergenic
967761530 3:193231304-193231326 AAGAGATCTGAAGAGTCCTGAGG + Intergenic
967889001 3:194351658-194351680 GAGAGCCCAGCAGGGGCCTGAGG - Intergenic
968893100 4:3382628-3382650 GAGAGAGCAGCAGAGAACTGAGG - Intronic
969113541 4:4858061-4858083 CCGAGATATGCTGAGGCCTGGGG - Intergenic
969553175 4:7886011-7886033 GGATGATCTGCGGAGGCCTGTGG - Intronic
969652716 4:8477480-8477502 GGGAGCTCTGCTGAGGCCTCTGG + Intronic
970191336 4:13522448-13522470 GAGCCACCTGCGGAGGCCTGTGG - Intergenic
970257545 4:14184296-14184318 GAGAGAGCTTAAGAAGCCTGAGG + Intergenic
971366125 4:25978445-25978467 GAGAAAGCTGCAGTGGCCAGAGG + Intergenic
971526099 4:27620825-27620847 GAGGGAGATGCAGAGCCCTGGGG - Intergenic
971581501 4:28347275-28347297 GATTCATCAGCAGAGGCCTGAGG - Intergenic
972390449 4:38608260-38608282 GAGAGGTCTTAAGATGCCTGAGG - Intergenic
972866002 4:43233472-43233494 GAGGAATCTGCAGATTCCTGAGG + Intergenic
976091232 4:81460293-81460315 GGGTGCTCTGCAGAGGCCAGAGG + Intronic
976420950 4:84843199-84843221 AAGAGATCTGGATAGGGCTGAGG + Intronic
976748873 4:88433608-88433630 GAGAACTCTGCAGAGTCCTGAGG - Intronic
983337405 4:166415146-166415168 ATGAGATCTGGAGAGGCCAGGGG - Intergenic
985720497 5:1486241-1486263 TAGAGCTCAGCAGAGCCCTGTGG - Intronic
985813714 5:2111035-2111057 GAGAGGTGGGCAGAGGCCTGCGG + Intergenic
986079177 5:4371756-4371778 TAGGGATGTGCAGGGGCCTGGGG - Intergenic
986312432 5:6562542-6562564 GGGGGCTCTGCAGAGTCCTGAGG - Intergenic
987317075 5:16733796-16733818 GAGAGTCCTGAAGAGGCCCGGGG - Intronic
987692426 5:21283868-21283890 GTGAGATGTGCAGAGGACTTGGG - Intergenic
988418279 5:30974129-30974151 GAGAGATCTAGAGAGGATTGAGG - Intergenic
988933422 5:36059569-36059591 GTGAGATGTGCAGAGGACTTGGG + Intronic
989117094 5:37965581-37965603 GAGAGAAATGCAGGGGCTTGAGG + Intergenic
990321279 5:54632247-54632269 CAGAGATGTGCAGACGCCAGGGG + Intergenic
991258952 5:64646181-64646203 GTGAAATCTGCAGAGGAATGAGG + Intergenic
991568352 5:68028886-68028908 GACAGAGCTGCAGCTGCCTGGGG - Intergenic
991747932 5:69766182-69766204 GTGAGATGTGCAGAGGACTTGGG + Intergenic
991799508 5:70346030-70346052 GTGAGATGTGCAGAGGACTTGGG + Intergenic
991829089 5:70664008-70664030 GTGAGATGTGCAGAGGACTTGGG - Intergenic
991891867 5:71345459-71345481 GTGAGATGTGCAGAGGACTTGGG + Intergenic
992441878 5:76804251-76804273 GAGCTGTCTGCAGAGGCTTGGGG - Intergenic
993352245 5:86864964-86864986 GAGAAATGTGCAGGGTCCTGTGG + Intergenic
995329085 5:110926614-110926636 GTGGGATCTGCAGAAGGCTGTGG + Intergenic
995629458 5:114117606-114117628 GAGATAGCTCAAGAGGCCTGGGG + Intergenic
996877920 5:128260349-128260371 GAGTGATCTGCAGAGTTCTCAGG + Intronic
997995720 5:138584432-138584454 GAGAGCTCTGCAGAGGAGGGAGG + Intergenic
998044534 5:138975743-138975765 GGGAGACCTGCACAGCCCTGTGG + Intronic
998253451 5:140567703-140567725 GAGTGATATGCAGGGGCATGGGG - Exonic
998526822 5:142850107-142850129 CAGAGCTCTGAAGAGGCCTAGGG - Intronic
999293316 5:150441796-150441818 TAGAGATAGGCAGAGGCCAGAGG + Intergenic
1000021010 5:157319649-157319671 GTGAGATGTCCAGAGGCATGAGG - Intronic
1000981840 5:167824631-167824653 GAAAGATAAGCAGAGCCCTGTGG + Intronic
1001055859 5:168449388-168449410 AAGTGAGCGGCAGAGGCCTGAGG - Intronic
1001965977 5:175910218-175910240 CAGAGATCTGCAGGGGCCAGGGG - Intergenic
1002250969 5:177928982-177929004 CAGAGATCTGCAGGGGCCAGGGG + Intergenic
1002473732 5:179452469-179452491 CTGAGGTCTGCAGAGGCGTGAGG - Intergenic
1002656458 5:180752355-180752377 GAGCCATCTGCAGAAGCCAGTGG - Intergenic
1003062944 6:2876488-2876510 GAGAGTTCTGGCGAGGGCTGCGG - Intergenic
1003284171 6:4719947-4719969 GAGAGAAATACAGAGGCCAGAGG - Intronic
1003863545 6:10343492-10343514 GAGGACTCTGCAGAGTCCTGAGG + Intergenic
1006347995 6:33498452-33498474 CTGAGACCTTCAGAGGCCTGTGG + Intergenic
1006585514 6:35108111-35108133 GAAGGTTCTGCAGAGCCCTGGGG - Intergenic
1006634266 6:35451185-35451207 GTCAGATCTTAAGAGGCCTGAGG - Intergenic
1006636905 6:35467671-35467693 GAGAGATCTGAAGGGCTCTGGGG + Intergenic
1006853552 6:37116890-37116912 GGGAGATGTGCAGGGGCCTGAGG - Intergenic
1006913293 6:37578257-37578279 GTCAGCTCTGCAGACGCCTGGGG + Intergenic
1012011084 6:93786587-93786609 GAGGAATCTTCAGAAGCCTGCGG - Intergenic
1012107829 6:95187877-95187899 AAGAGATCTTAAGATGCCTGTGG - Intergenic
1012180396 6:96145696-96145718 GACAGATGTGCAAAGGCCTGAGG + Intronic
1014134762 6:117875915-117875937 GAGAAATTGTCAGAGGCCTGAGG - Intergenic
1014317608 6:119886877-119886899 GTGAAATCTGGAGAGGACTGAGG + Intergenic
1016602883 6:145882704-145882726 AAGAGATCAGAAGAGGCATGAGG + Intronic
1016618110 6:146076607-146076629 GAGTGATATGCAGAAGCCAGTGG + Intronic
1016676756 6:146779305-146779327 AAGAGATCTTCAGAGACTTGTGG + Intronic
1018953079 6:168391599-168391621 GACAGATGTGCTGAGGCATGAGG - Intergenic
1019224622 6:170499995-170500017 GAGGGATCTGGAGTGGGCTGAGG - Intergenic
1019472881 7:1230442-1230464 GAGAGCTCTTCAGAGGCCCTCGG - Intergenic
1020045067 7:5034475-5034497 AAGAGACCAGCAGAGTCCTGAGG + Intronic
1020290476 7:6718841-6718863 AAGAGACCAGCAGAGTCCTGAGG + Intergenic
1020470227 7:8526483-8526505 AAGAGATTTGGAGAGGCCAGGGG + Intronic
1021092246 7:16497307-16497329 GAGAGATGAGCAGAGCCATGGGG + Intronic
1022602266 7:31772484-31772506 GAGAGAACTGCAGAAGCCCTGGG - Intronic
1023729418 7:43176519-43176541 GGGGACTCTGCAGAGGCCTGAGG + Intronic
1024526324 7:50353098-50353120 GAAAGAGCTGGAGAAGCCTGAGG + Intronic
1024934379 7:54698104-54698126 GAGTGTTCTGCAGAGGCTTGGGG + Intergenic
1025998386 7:66542897-66542919 CAGAGCTCTGCAGCAGCCTGTGG - Intergenic
1026594456 7:71722746-71722768 GAGATTTCTACAGAGGCCTGCGG + Intergenic
1026991347 7:74587698-74587720 CAGAGCTCTGCAGCAGCCTGTGG - Intronic
1027126152 7:75558095-75558117 GAGAGAGCGGCTCAGGCCTGTGG - Intronic
1028267762 7:88748787-88748809 GAGGGACCTGTAGAGTCCTGAGG - Intergenic
1028890640 7:95984622-95984644 GGGACATCTGCAGAAGCCTTTGG + Intronic
1029397202 7:100316623-100316645 AAGAGACCAGCAGAGTCCTGAGG - Intronic
1031269050 7:119621486-119621508 GAGATATCTGCAAAGTGCTGAGG + Intergenic
1032011577 7:128351211-128351233 GAGAGATCAGGGGAGGCCTCTGG - Exonic
1032498077 7:132377790-132377812 GAGTGAAATGCAGAGACCTGGGG + Intronic
1033019157 7:137704499-137704521 AACAGATCTTCAGAGACCTGTGG + Intronic
1033127507 7:138718561-138718583 GAGACATCCGGAGAGGCATGGGG + Intronic
1033342853 7:140505518-140505540 GAGAAAGCAGCAGGGGCCTGTGG + Intergenic
1033919699 7:146375325-146375347 GTGACATCTGCAGAGACATGCGG + Intronic
1034470430 7:151251825-151251847 GAGAGATGCGCCGCGGCCTGCGG + Intronic
1034759010 7:153653664-153653686 GAGTGATCTGGAGAGGCATGTGG - Intergenic
1034882598 7:154773961-154773983 TAGAATTCTGCAGAGGCCTCGGG - Intronic
1035102253 7:156410396-156410418 GACAGAGCCTCAGAGGCCTGTGG - Intergenic
1035596990 8:866221-866243 GGAAGATCTGGACAGGCCTGGGG - Intergenic
1035870496 8:3132165-3132187 GAGATATCTGCTGAGGTCTGAGG - Intronic
1035922421 8:3692093-3692115 GACTCATCTGGAGAGGCCTGGGG + Intronic
1037078765 8:14756519-14756541 GAGTCATCTGCAGAGTACTGTGG - Intronic
1037197946 8:16215016-16215038 GAAGGTTCTGCAGAGCCCTGGGG + Intronic
1037481444 8:19309723-19309745 GGGACATCTGCAGTGGCCTATGG - Intergenic
1037729375 8:21511000-21511022 GAGAGATTTGCTGAGGCTAGAGG + Intergenic
1037800728 8:22033875-22033897 GAAAGCCCTGCAGAGGGCTGGGG - Intronic
1039116408 8:34095940-34095962 GGCAGATCTGCAGTGGCCTGAGG + Intergenic
1041017873 8:53609457-53609479 GAGAGAATCCCAGAGGCCTGGGG + Intergenic
1041095180 8:54342622-54342644 GAGAGAACTGGTGGGGCCTGGGG + Intergenic
1041675604 8:60535777-60535799 GAGAGAGCAGTAGAGGCCAGTGG - Intronic
1045109520 8:98926934-98926956 GTGAGAACTGCAGGGGCATGGGG + Intronic
1045294559 8:100862026-100862048 GAGAGATCTGCAGAGCTCTGAGG + Intergenic
1045389754 8:101703796-101703818 GAGAGAACTCCAGAGAGCTGTGG + Intronic
1045590583 8:103590382-103590404 CAAAGATCTGCAGACACCTGGGG - Intronic
1046355645 8:113081705-113081727 GAGAAATCTGCAGAGTCCCAGGG - Intronic
1047183507 8:122611701-122611723 GAAAGATGAGCAGAGGCCTCAGG - Intergenic
1048045786 8:130771540-130771562 GAAACATCTCCAGGGGCCTGAGG - Intergenic
1048303577 8:133268122-133268144 GGCAGCTATGCAGAGGCCTGTGG - Intronic
1048318139 8:133377070-133377092 GAGGGCTCTGCTGAGGTCTGGGG + Intergenic
1048469258 8:134692487-134692509 CAGAGAATGGCAGAGGCCTGAGG - Intronic
1049551098 8:143260335-143260357 GATGGCTCTGCAGTGGCCTGAGG - Intronic
1051022400 9:12559755-12559777 GAGAGTTCTTCAGAGTCCTCAGG + Intergenic
1052384700 9:27809095-27809117 GAGAGGTATGCAATGGCCTGTGG + Intergenic
1052855624 9:33404541-33404563 GAGTGACTTGCAGAGGGCTGCGG + Intergenic
1053154116 9:35762669-35762691 CAGAAATCTCCAGAGGGCTGAGG - Intergenic
1055157345 9:73080402-73080424 GAGAGATCTGCAGACTCCCAGGG - Intronic
1055402728 9:75941762-75941784 AAGAGACCTGAAGAGGCATGTGG + Intronic
1056774269 9:89499469-89499491 CAGAGGTTTGCTGAGGCCTGAGG - Intergenic
1057079794 9:92164600-92164622 TACAGACCTGCAGATGCCTGGGG + Intergenic
1059164891 9:112068246-112068268 TAGACATCTGCAGAGGCATGAGG + Intronic
1059316558 9:113430608-113430630 GAGAAATCTGCAGAGCCAAGTGG + Intergenic
1059524567 9:114978656-114978678 GAGAGCTCTGCAGAGCCCCAAGG - Intergenic
1059536053 9:115081890-115081912 GAGAGATCACCAAAAGCCTGAGG - Exonic
1059721464 9:116963986-116964008 AAGAGATCTGCAGTGCCCTGTGG - Intronic
1060147836 9:121267892-121267914 GGGAGATCTGAAGAGGCCTAGGG - Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1060852716 9:126890431-126890453 GAGAGATCTCAAGAGGGCAGAGG + Intergenic
1061296082 9:129677519-129677541 GAGAGCTCTGCAGTGTCCTGAGG + Intronic
1061697461 9:132387578-132387600 GAAAGAGCAGCAGAAGCCTGTGG - Intronic
1061723251 9:132566778-132566800 AACAGATCCGCAGAGGCCAGAGG - Intronic
1062494017 9:136823134-136823156 GAGCAATCCGCAGAAGCCTGGGG + Intronic
1062618347 9:137407989-137408011 GGGAGATCCCCAGAGGCATGAGG - Intronic
1185652470 X:1658373-1658395 GAGAGAGCTCCTGAGACCTGCGG + Intergenic
1186500894 X:10049850-10049872 GAGGGAACTGCAGTGGCCTGGGG + Intronic
1187232783 X:17438437-17438459 GAGAAAGCTGCCGAGGCCTAGGG - Intronic
1189002644 X:36963078-36963100 GAGAGAATTGCAAGGGCCTGCGG - Intergenic
1189319575 X:40079607-40079629 CAGAAATCTGCAGAGGCATCAGG + Intronic
1191221278 X:57990343-57990365 CAGAGAACTGCAGAGACATGGGG + Intergenic
1192326858 X:70140049-70140071 GACTGATCTGGAAAGGCCTGAGG - Intronic
1192873674 X:75207800-75207822 GAGAGGTATGCAGTGGCTTGTGG + Intergenic
1193080194 X:77399111-77399133 AAGGGATCTGCAGAGGGCAGTGG - Intergenic
1193939864 X:87668982-87669004 TAGAGACCTGCAGAGGCCCAGGG + Intronic
1194142041 X:90219713-90219735 GAGAGGTATGCAGTGGCTTGTGG + Intergenic
1195998039 X:110750941-110750963 GTGGGATCTCCAGAGGGCTGTGG - Intronic
1197414578 X:126159340-126159362 GAAAGAAGTGCGGAGGCCTGAGG - Intergenic
1198421815 X:136475872-136475894 GAGAGATCTTCAGAGGCCACAGG + Intergenic
1200135769 X:153873889-153873911 CAGTGCTCTGCAGAGTCCTGGGG - Intronic
1202068743 Y:20968569-20968591 GAGACATGAGCATAGGCCTGGGG - Intergenic