ID: 907989545

View in Genome Browser
Species Human (GRCh38)
Location 1:59565961-59565983
Sequence CTGTGGTCAAGTACCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907989540_907989545 -6 Left 907989540 1:59565944-59565966 CCCTGTTCCCTGCTGCGCTGTGG 0: 1
1: 0
2: 2
3: 26
4: 271
Right 907989545 1:59565961-59565983 CTGTGGTCAAGTACCAAATTTGG 0: 1
1: 0
2: 0
3: 8
4: 87
907989537_907989545 9 Left 907989537 1:59565929-59565951 CCCTATTTAATCTTCCCCTGTTC 0: 1
1: 0
2: 0
3: 23
4: 266
Right 907989545 1:59565961-59565983 CTGTGGTCAAGTACCAAATTTGG 0: 1
1: 0
2: 0
3: 8
4: 87
907989542_907989545 -7 Left 907989542 1:59565945-59565967 CCTGTTCCCTGCTGCGCTGTGGT No data
Right 907989545 1:59565961-59565983 CTGTGGTCAAGTACCAAATTTGG 0: 1
1: 0
2: 0
3: 8
4: 87
907989539_907989545 -5 Left 907989539 1:59565943-59565965 CCCCTGTTCCCTGCTGCGCTGTG No data
Right 907989545 1:59565961-59565983 CTGTGGTCAAGTACCAAATTTGG 0: 1
1: 0
2: 0
3: 8
4: 87
907989538_907989545 8 Left 907989538 1:59565930-59565952 CCTATTTAATCTTCCCCTGTTCC 0: 1
1: 0
2: 1
3: 22
4: 245
Right 907989545 1:59565961-59565983 CTGTGGTCAAGTACCAAATTTGG 0: 1
1: 0
2: 0
3: 8
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907989545 Original CRISPR CTGTGGTCAAGTACCAAATT TGG Intronic
907989545 1:59565961-59565983 CTGTGGTCAAGTACCAAATTTGG + Intronic
910839206 1:91545866-91545888 CTGTGATCAGGTGCTAAATTGGG - Intergenic
916677758 1:167078119-167078141 ATGTGGTCAAGGAACAAAATAGG - Intronic
922677949 1:227564217-227564239 CTGTCGTCAATTATTAAATTTGG - Intronic
1068906370 10:62328798-62328820 CTGTAATGAGGTACCAAATTGGG + Intergenic
1070498234 10:77044921-77044943 CTGTGTACAAGTACCAAAGAGGG + Intronic
1071100094 10:82026511-82026533 CTGTGATTAAGAATCAAATTTGG - Intronic
1073576856 10:104633341-104633363 CTGTGTTCAAGTAGCAAGGTTGG - Intergenic
1075994865 10:126869117-126869139 CTGTGGTCAGATACCGAAGTGGG - Intergenic
1076472746 10:130730071-130730093 CTGTGCTCAGGGACCAAAGTGGG + Intergenic
1078818697 11:14853543-14853565 ATGTGGTTAAGTAACAAAGTAGG + Intronic
1081194471 11:40144425-40144447 CTGGGGACAAGTACCACATTTGG - Intronic
1081343607 11:41956409-41956431 CTGTGGTGAAGTCCCAGGTTGGG - Intergenic
1085500763 11:77020939-77020961 ATGTGGTCAAGTACTGAACTGGG - Exonic
1086399728 11:86450605-86450627 ATGGGGTCAAGTAACAAATCAGG - Intronic
1087241076 11:95780970-95780992 CTGTAAACAAGTACCAAGTTGGG + Intronic
1097675773 12:62601894-62601916 CCGTGGTCTAGAACAAAATTTGG - Exonic
1098218394 12:68243417-68243439 CTCTGGCCAAGTTCCAAATTTGG - Intergenic
1098535954 12:71593735-71593757 CTGTCTTCAAGTAAGAAATTTGG + Intergenic
1100102590 12:91126920-91126942 CTTTGGTCAAGAACAATATTAGG + Intergenic
1103040356 12:117690116-117690138 CTGTGGCCATGGACCAAACTTGG - Intronic
1105376006 13:19845207-19845229 CTGAGGTCAAGAACAAAATAAGG + Intronic
1109580529 13:64326799-64326821 CGATGGTCAAATACAAAATTAGG - Intergenic
1110428679 13:75398739-75398761 CTCAGGTCAAGGACCAAAATAGG + Intronic
1114830709 14:26138087-26138109 CTGAGGTCAAGTACCAGAGAGGG + Intergenic
1115077513 14:29409589-29409611 CTGTGGTCAAGCACTTAATAAGG + Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1128545778 15:68566651-68566673 CTGTGGTTAAGGAGCAAATAAGG + Intergenic
1131933225 15:97469862-97469884 TTGTGTACAAGCACCAAATTTGG + Intergenic
1133193339 16:4150791-4150813 CTGTGGTAAAGTCACATATTCGG + Intergenic
1133703198 16:8328489-8328511 CTGTGGTCTACTACAGAATTTGG + Intergenic
1137357200 16:47778270-47778292 GTGTGGGCAAGCCCCAAATTTGG + Intergenic
1138543402 16:57701961-57701983 CTGTGCTCAAGTACCAGAAGGGG + Exonic
1139276408 16:65731832-65731854 TTGTTTTCAAGTATCAAATTTGG + Intergenic
1139383419 16:66549065-66549087 TTGTGGTCATGTAGCAAATTAGG - Intronic
1144864516 17:18326521-18326543 CTGTGGTCTATTTCCAAATTTGG - Intergenic
1146622184 17:34407501-34407523 CACTGGTCAAGTACAAGATTTGG + Intergenic
1149284267 17:55144608-55144630 CTGTCCTCAAGTACAAAACTGGG - Intronic
1149616555 17:58006170-58006192 CTGTGGTGATTTACCAAATTAGG - Intronic
1157994905 18:52543568-52543590 GTGTGGTCAAGAAACAGATTTGG + Intronic
925203092 2:1984883-1984905 CTGATGTCAAGTACCACATTAGG + Intronic
928210351 2:29319348-29319370 CTGTTATTAAGTAACAAATTCGG + Intronic
930129902 2:47839389-47839411 CTGTGGGAAAGTAACAAATAGGG - Intronic
935796085 2:106642639-106642661 CTGTGATCAAGATCCATATTTGG + Intergenic
937632716 2:124121602-124121624 CTGTGGTCAAATGGTAAATTAGG + Intronic
939684470 2:145181631-145181653 GTGTGGGCAAATACCAAATTTGG + Intergenic
940579133 2:155553880-155553902 CTGTTGTCAGGTATCAAATGAGG - Intergenic
940620091 2:156101437-156101459 CTGTGGTCACTTAACACATTTGG - Intergenic
940816144 2:158299836-158299858 CTGTGGAGAACTACCAAATGTGG + Intronic
944416087 2:199481202-199481224 CTGTGGTGAATTACGAAATGTGG - Intergenic
947073646 2:226318447-226318469 CCGTGATCAAAAACCAAATTAGG + Intergenic
947964902 2:234271752-234271774 CTGTGGACAGGTTCCAATTTGGG - Intergenic
1172157984 20:32842778-32842800 CTGTGTTCAAGTCCCAGATGAGG + Intronic
1172787721 20:37480202-37480224 CTCTGGTGAAGCACCATATTTGG - Intergenic
1175298233 20:57923930-57923952 CAGTGGTCAAGCACCGAACTAGG + Intergenic
955019672 3:55107116-55107138 CTGAGCTGAAGAACCAAATTAGG + Intergenic
957741259 3:84272131-84272153 ATATGGGAAAGTACCAAATTTGG - Intergenic
963463220 3:145644060-145644082 CTGTGGTAAGATACCAAATGGGG + Intergenic
965762781 3:172097321-172097343 CTGTGGTTAAGTAATAGATTTGG - Intronic
966852192 3:184171066-184171088 CTGGGGTCAACTCCCAAAATGGG - Exonic
968807978 4:2787497-2787519 CTGCTTTCAAGTTCCAAATTGGG + Intergenic
971754233 4:30686439-30686461 CTTTGGTCAAGTTCCAATTAGGG + Intergenic
973305996 4:48650903-48650925 CTGTGGTCAAGGACCGAAAGGGG + Intronic
979279977 4:118856187-118856209 CTGTGTGCAAGTAACATATTCGG + Intronic
982864010 4:160488018-160488040 TTGTGTTCAAGTCCCAACTTAGG + Intergenic
986109691 5:4700533-4700555 CTTTGGTCAAGAGCCAAGTTAGG + Intergenic
987741055 5:21909182-21909204 CTGTGTTCATCTACCAAATCTGG + Intronic
989056464 5:37370747-37370769 CTGGGGATAAGTAGCAAATTAGG + Intronic
990890503 5:60644104-60644126 CTGTGGATAAGGACCAGATTTGG - Intronic
991342743 5:65629350-65629372 CTTTGGTAAAATACCACATTGGG + Intronic
994220318 5:97187704-97187726 CTGTGGTGTAGTACCAAAGGAGG - Intergenic
995404004 5:111773803-111773825 CTGTGTGCCAGAACCAAATTTGG - Intronic
996415043 5:123201656-123201678 CTGGAGTCAAATTCCAAATTCGG + Intergenic
996800053 5:127393261-127393283 CTGAATTCAAGTACCACATTTGG - Intronic
999882891 5:155886887-155886909 CTGTGGTTCAGAACCACATTGGG + Intronic
1001685496 5:173591777-173591799 CTGTGGTAAATTACCATGTTTGG - Intergenic
1003811354 6:9786013-9786035 CTATAGCCAAGTATCAAATTGGG + Intronic
1007642371 6:43352303-43352325 CTGTGTGAGAGTACCAAATTTGG + Intronic
1009712138 6:67337565-67337587 CAATAGTCAAGTCCCAAATTAGG - Intergenic
1012646192 6:101685012-101685034 CTATAGCCAAGTACCATATTTGG + Intronic
1016718059 6:147256961-147256983 ATGTAGTCAAGCACAAAATTTGG - Intronic
1018922118 6:168182619-168182641 CTGTGTTCAATTTCCACATTAGG - Intergenic
1019028101 6:168989089-168989111 GTGTGCTTAAGTACTAAATTAGG + Intergenic
1021316720 7:19157077-19157099 CTTTGGACAAGTCCCACATTGGG - Intergenic
1027931313 7:84538463-84538485 CTGGAATCAAGAACCAAATTGGG + Intergenic
1031333901 7:120502135-120502157 CTGTGTTTAAGTAGCAAACTCGG + Intronic
1032329798 7:130967388-130967410 CTGTTGTCAAGAACCAAAAAAGG - Intergenic
1038897185 8:31797285-31797307 TTTTGGTCATGGACCAAATTTGG + Intronic
1039649377 8:39325083-39325105 CTGTTTTCAAGTACAAAATTAGG - Intergenic
1044337414 8:91003756-91003778 GTGCGGTCAAGTTCCAACTTTGG + Intronic
1044685434 8:94821896-94821918 CTGGGGTGAAGTTCCAATTTGGG + Intronic
1045441364 8:102215611-102215633 CAGAGGTCAAGTACCTAAATGGG + Intronic
1046348427 8:112969715-112969737 CTGTTTTTAAGTACAAAATTTGG - Intronic
1047008995 8:120650700-120650722 ATGAGGTCAAATAACAAATTAGG - Intronic
1052741790 9:32400321-32400343 ATGTGGTTCAGTAACAAATTTGG + Intronic
1198930615 X:141854792-141854814 ATGTGGACAAGTCCAAAATTGGG + Intronic