ID: 907990866

View in Genome Browser
Species Human (GRCh38)
Location 1:59581305-59581327
Sequence CTAGTTGAGAACATTTCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907990858_907990866 18 Left 907990858 1:59581264-59581286 CCCTGAGACCATTTGCATGAGGG No data
Right 907990866 1:59581305-59581327 CTAGTTGAGAACATTTCTATTGG No data
907990856_907990866 30 Left 907990856 1:59581252-59581274 CCTATTTTTATTCCCTGAGACCA 0: 1
1: 0
2: 0
3: 20
4: 274
Right 907990866 1:59581305-59581327 CTAGTTGAGAACATTTCTATTGG No data
907990862_907990866 10 Left 907990862 1:59581272-59581294 CCATTTGCATGAGGGGAAATTTA No data
Right 907990866 1:59581305-59581327 CTAGTTGAGAACATTTCTATTGG No data
907990860_907990866 17 Left 907990860 1:59581265-59581287 CCTGAGACCATTTGCATGAGGGG No data
Right 907990866 1:59581305-59581327 CTAGTTGAGAACATTTCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907990866 Original CRISPR CTAGTTGAGAACATTTCTAT TGG Intronic
No off target data available for this crispr