ID: 907996255

View in Genome Browser
Species Human (GRCh38)
Location 1:59635891-59635913
Sequence CTTCAGAATCACAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907996250_907996255 0 Left 907996250 1:59635868-59635890 CCTAAGATACAGAAAGTCCATGG 0: 1
1: 0
2: 0
3: 20
4: 217
Right 907996255 1:59635891-59635913 CTTCAGAATCACAAGGAGAAGGG 0: 1
1: 0
2: 1
3: 47
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907996255 Original CRISPR CTTCAGAATCACAAGGAGAA GGG Intronic
900089260 1:912547-912569 GTTCAGAAGCTCAAGGACAATGG + Intergenic
900315010 1:2052084-2052106 CTCCAGAATGGCAAGGAGACAGG - Intronic
901032074 1:6312999-6313021 CCTCAGCATCGCAAGGAGCAAGG + Intronic
901775332 1:11556726-11556748 CCGCAGAATCAAAAGGAGGATGG + Intergenic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
905357639 1:37395877-37395899 CTTCAGAAACAAAATGTGAAAGG + Intergenic
907326351 1:53640982-53641004 CTTCAAAAGCACAGGGAGACAGG + Intronic
907996255 1:59635891-59635913 CTTCAGAATCACAAGGAGAAGGG + Intronic
908297773 1:62730450-62730472 CTTCAGTATTCCAAGGAAAATGG - Intergenic
908313296 1:62907242-62907264 CTCCATAAGCACAAGGAGAGGGG + Intergenic
908360966 1:63367918-63367940 CCTCAGAACCGCAAGGACAAGGG - Intronic
908433279 1:64079998-64080020 CTCCAGATCCACAATGAGAAGGG - Intronic
908566981 1:65367202-65367224 CTTCTGATTCAGAAGGACAAGGG + Intronic
910298983 1:85684000-85684022 TTTGAGAACCACAAGGATAAAGG + Intronic
910349757 1:86281804-86281826 CCTCAGTCTCAGAAGGAGAAAGG + Intergenic
911738221 1:101360641-101360663 CTTCAGAATCATGAGGAACATGG + Intergenic
913210560 1:116579014-116579036 TTTCAGACTCACAAGGGAAAGGG - Intronic
913528843 1:119718668-119718690 CTTCACAACTCCAAGGAGAAGGG - Intronic
914193658 1:145432005-145432027 CTTCAGAATCACCCAGTGAACGG + Intergenic
914387521 1:147185440-147185462 CTCCAGTATCACAAGGATTAGGG + Intronic
914474987 1:148014895-148014917 CTTCAGAATCACCCAGTGAACGG + Intergenic
915825654 1:159073237-159073259 CTTCAGGAGGAGAAGGAGAAAGG - Exonic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
916754753 1:167758485-167758507 CATCACAATCACAAAGAAAAAGG - Intronic
917168197 1:172137937-172137959 CTTCAGAAGCATAAGGAAAGTGG - Intronic
918225131 1:182474348-182474370 CTTCTGAATAACAAAAAGAATGG + Exonic
918501342 1:185199853-185199875 CTTGAAAATGACAGGGAGAATGG - Intronic
919327960 1:196133346-196133368 TTTGAGAATCACAAGGCTAAGGG - Intergenic
919506061 1:198398824-198398846 CTTCAGCATCCCAAGTAGCAGGG - Intergenic
920599438 1:207308320-207308342 CTTCAAAATCCTAAGGAAAATGG + Intergenic
921697194 1:218225276-218225298 CTGCAGTATCACTGGGAGAAGGG - Intergenic
922076430 1:222249373-222249395 CTTCAGCCTCACAAGTAGCAAGG + Intergenic
924374168 1:243388431-243388453 CTTCAGAACCACATGGAATAAGG + Intronic
924697778 1:246418532-246418554 CTTCCTTATCACAAGGACAAAGG + Intronic
1062966590 10:1611989-1612011 CTTCAGAATCACAAGGAATTAGG + Intronic
1063817484 10:9792251-9792273 CCTCAGAATCTAGAGGAGAAAGG + Intergenic
1065115908 10:22482207-22482229 CCTCAGGATCAAAAGGAGGAGGG + Intergenic
1066006772 10:31153151-31153173 CTTCAGAATTAGAAGGGAAATGG - Intergenic
1066794618 10:39105727-39105749 CTTCAGATTAAAAAGTAGAAAGG + Intergenic
1067736836 10:48861801-48861823 CATCAGAATCCCAAAAAGAATGG - Intronic
1068078506 10:52289136-52289158 TTTCATAATCACAACTAGAAAGG - Intronic
1068917446 10:62447607-62447629 CTTCAGAACAACAGGGTGAATGG - Intronic
1069324679 10:67218585-67218607 CTCCAGAATCACACACAGAATGG - Intronic
1069557230 10:69406406-69406428 CCTCAGAATCACGAGGCGTAGGG + Intronic
1070345626 10:75538788-75538810 CTTCAGACCCCCAAGGTGAAAGG + Intronic
1071446528 10:85753825-85753847 CTTCCGGAACACAAGAAGAAGGG - Intronic
1072569573 10:96646783-96646805 CTTCACAATCACATGGAGGCAGG - Intronic
1072576266 10:96703331-96703353 CTTCTGAAACACAATGGGAATGG + Intronic
1072799024 10:98379396-98379418 CTGCAGCATCACAAAGGGAAAGG - Intergenic
1073575424 10:104618789-104618811 TTTCTGAAGCACAATGAGAATGG - Intergenic
1074415386 10:113262858-113262880 TTTCAGCAGCACAAGGAGAATGG + Intergenic
1074870468 10:117571967-117571989 CTTCTGAATGACAAGGGTAAGGG + Intergenic
1074910037 10:117900080-117900102 CTTCAGAAGCACAGGGACTAAGG + Intergenic
1077169624 11:1160424-1160446 CTTCAGACTCACATGGACAGAGG + Intronic
1077538821 11:3136948-3136970 CTCTAAAATCACAAGGATAAAGG + Intronic
1077645483 11:3919825-3919847 CTTCAGCATCCCAAGTAGCAGGG - Intronic
1077717717 11:4598635-4598657 CTTGAGAATCAGTAGTAGAAGGG - Intergenic
1077965690 11:7130373-7130395 CATCAGAATCCCAGGAAGAAAGG - Intergenic
1078871289 11:15347571-15347593 CCTGAGAATCAAAAAGAGAAAGG - Intergenic
1078872795 11:15364539-15364561 CTTCAGAATCCCCATGAGAAAGG - Intergenic
1079181036 11:18193745-18193767 CTGCAGAATCACAAGGATGAGGG - Intronic
1079442897 11:20533533-20533555 TTTCAGAAACGCAAGAAGAATGG - Intergenic
1079812471 11:25012489-25012511 CTTCAGCAGCACCAGCAGAAGGG - Intronic
1080334689 11:31182125-31182147 CTTGAAATTGACAAGGAGAATGG + Intronic
1080454311 11:32404364-32404386 CTGCTGAATGACAGGGAGAAGGG + Intronic
1082107608 11:48237300-48237322 CTGCAAAATTACAAGGAGCAGGG - Intergenic
1082697181 11:56382937-56382959 TTTCAAAATAACAAAGAGAATGG - Intergenic
1083071520 11:59988762-59988784 CATAATAATCACATGGAGAATGG + Intergenic
1083601605 11:63952149-63952171 CCTCAGAATCACAGGGAGGAAGG - Intronic
1085409255 11:76281803-76281825 CTCCAGAGTCACAAGGAGGCAGG - Intergenic
1085608992 11:77929365-77929387 CTTTAGTATCACAAGGACTATGG + Intronic
1087870175 11:103284110-103284132 CATCAGAATCACCTGGGGAATGG - Intronic
1088435875 11:109812669-109812691 CTCCAGCATCCCAAGGAGAAAGG + Intergenic
1089216175 11:116835986-116836008 CTTGAGGCTCTCAAGGAGAACGG - Exonic
1089828257 11:121299305-121299327 CTTGAGAATCTTAAAGAGAAGGG - Intronic
1090250203 11:125245670-125245692 CTGCTGACTCACCAGGAGAAGGG + Intronic
1090394397 11:126409136-126409158 CTTCAGGAGCACAAGGTGAGAGG - Intronic
1091694913 12:2622012-2622034 ATGCAGAATCACAAGGAAACTGG + Intronic
1091798226 12:3309232-3309254 CTTAAGGAACACAAGGAGAGGGG + Intergenic
1092617441 12:10228292-10228314 GTTGAGAATGACTAGGAGAAAGG - Intergenic
1092741596 12:11635796-11635818 ATTCAGAATCACAAGAGAAAGGG + Intergenic
1092797939 12:12132058-12132080 CTTCAAATGAACAAGGAGAAGGG + Intronic
1094404583 12:30102437-30102459 CTTTAAAATGACAAGTAGAAGGG - Intergenic
1095357896 12:41297757-41297779 CTTGAGAATCACATGGACAAGGG - Intronic
1095909788 12:47414587-47414609 CTTCAGAGTTAAAAGGGGAAAGG + Intergenic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1098302697 12:69070303-69070325 CATCAGAATCACATGGGAAATGG + Intergenic
1098455609 12:70669841-70669863 CTTCAGAAAACCAAGGTGAAAGG - Intronic
1098983378 12:76984432-76984454 CTCCTGAAGCACAAGGAGAAAGG - Intergenic
1099042912 12:77678289-77678311 ATTCAGCATCACCAGAAGAATGG + Intergenic
1099716016 12:86295026-86295048 CATCACAATTACATGGAGAATGG + Intronic
1099793364 12:87363911-87363933 CATGAGAATCACATGGGGAAGGG - Intergenic
1101083644 12:101213786-101213808 CCTCACAATCAGAAGGAGAACGG - Intergenic
1102425281 12:112839044-112839066 CCTGAGACTCACAAGGAGAAAGG - Intronic
1104198580 12:126565748-126565770 CTACAGAATGAGAGGGAGAAAGG - Intergenic
1104217373 12:126747419-126747441 CTTCAGAATCAATTGGAGGAAGG + Intergenic
1105476186 13:20729947-20729969 CTTCAGAAGCCCAAGGCGACGGG - Intronic
1106323170 13:28661123-28661145 CTGCAGAATCACAGGGATATTGG + Intronic
1107485987 13:40827995-40828017 CATCAGAAACAAAAGTAGAATGG + Intergenic
1108457545 13:50631395-50631417 ATTCTGAAACACAAGGAAAAAGG + Intronic
1108819729 13:54334117-54334139 CTTCTGAATCACACTGGGAATGG - Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109536161 13:63722432-63722454 CTTCAGAAACCCAAGAAAAAGGG - Intergenic
1109539939 13:63763854-63763876 CTTCAGAAACCCAAGAAAAAGGG + Intergenic
1110523436 13:76507370-76507392 TTTCAGAGTAACAAGGAGAAGGG + Intergenic
1110700207 13:78538146-78538168 CTTCAGGAACACAAGGGAAAAGG + Intergenic
1112136029 13:96578500-96578522 CTTCAGCAGCCCAAGGACAAAGG - Intronic
1112262454 13:97889551-97889573 TTTCAGAAACAAAAGGAGACAGG + Intergenic
1112262642 13:97891392-97891414 TTTCAGAAACAAAAGGAGACAGG - Intergenic
1112581056 13:100676272-100676294 CTTCACTATCACAGGGAGACAGG - Intergenic
1112594670 13:100796912-100796934 CTGCAGAACCACAGGGAGATGGG + Intergenic
1112665550 13:101568523-101568545 CATCAGCATCCCAAGGAGAAAGG + Intronic
1113046974 13:106167186-106167208 TTTCAGAATCCAAGGGAGAAAGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1114705456 14:24721948-24721970 CATTGGAATCACAAGGAGAGAGG - Intergenic
1115375085 14:32665645-32665667 CTTAAGACTCACAATCAGAAAGG + Intronic
1115611967 14:35057309-35057331 CTTCAGCCTCACAAGTAGTAGGG + Intronic
1116360230 14:43985225-43985247 CTTAACAAACAAAAGGAGAAAGG - Intergenic
1118324924 14:64774304-64774326 CTTCAGATTTAAAAGGAAAATGG - Intronic
1119708433 14:76802905-76802927 CTTCAAAGCAACAAGGAGAATGG - Intronic
1120317238 14:82911102-82911124 CTTCAGAATAAAAAGAAGAAAGG + Intergenic
1120790817 14:88580077-88580099 CTTCAGCCTCCCAAGGAGACAGG - Intronic
1121423768 14:93833748-93833770 CTTCACAATCACCAGCACAATGG - Intergenic
1121734589 14:96209106-96209128 CTTTAGAATCACCTGGAGACTGG + Intronic
1121860990 14:97318002-97318024 CTTCAAGATCACAGGGTGAAAGG - Intergenic
1121924745 14:97917322-97917344 CTTCAGAAACACAGGTAGAGAGG - Intergenic
1123219489 14:106842842-106842864 CCAGAGAATAACAAGGAGAATGG - Intergenic
1124245393 15:28066697-28066719 CTTCAGGATCAGAAAGGGAAGGG - Intronic
1125670844 15:41471592-41471614 CTTCAGTATAAAAGGGAGAAGGG + Intronic
1126857786 15:52855603-52855625 TATCTGAAACACAAGGAGAATGG - Intergenic
1127629923 15:60818595-60818617 CTTCTGCATCCCAAAGAGAAGGG - Intronic
1128346233 15:66854282-66854304 CTTGAGAATCACAAGGCGTGTGG + Intergenic
1132403870 15:101530595-101530617 CATCAGAATGCCAAGGAGGAAGG - Intergenic
1133602087 16:7349593-7349615 CCTCAGAATCAAAATGAGGATGG + Intronic
1134798416 16:17062516-17062538 CAGCAGAAACACAAAGAGAATGG - Intergenic
1135492858 16:22924952-22924974 CTGCAGAATAACCATGAGAAGGG + Intergenic
1137525250 16:49229603-49229625 CCTGAAAATGACAAGGAGAATGG + Intergenic
1137866549 16:51903023-51903045 CTTAAGCCTCACAAGGAGATAGG + Intergenic
1138117599 16:54372836-54372858 CTCCAGATTCCCAAGGAAAATGG + Intergenic
1138364490 16:56462980-56463002 CTTCAAAATAAAAAAGAGAAGGG - Intronic
1139096459 16:63710536-63710558 CTTCAGCCTCACAAGGAGCTAGG - Intergenic
1139566589 16:67781282-67781304 CTTGAGATTACCAAGGAGAAAGG + Intronic
1140991067 16:80212069-80212091 GTTCACCATCCCAAGGAGAATGG - Intergenic
1141229362 16:82150351-82150373 CTTCAGATTGAGAAGGAGAGGGG - Intronic
1141622297 16:85242707-85242729 CATCAGAATCCCCAGGAGCAGGG - Intergenic
1141683170 16:85555686-85555708 GTTCAGAACCAGAAGGAAAAAGG - Intergenic
1141906205 16:87028617-87028639 GAACAGAATCACAAGGAGAGGGG + Intergenic
1144937078 17:18908495-18908517 CTCCTGAAACACAAGGAGAAAGG + Intronic
1145304344 17:21664814-21664836 CTACAGCAACACAAGGAGACAGG + Intergenic
1146966330 17:37034165-37034187 CTTAGGAAACACAATGAGAATGG - Intronic
1148447309 17:47745309-47745331 CTTCCTTATCAAAAGGAGAAGGG - Exonic
1150897297 17:69227518-69227540 CTTCTGAGACAAAAGGAGAAAGG - Intronic
1152138540 17:78522475-78522497 CTCCTGAAGCACAAGGAGAAAGG + Intronic
1152182073 17:78828707-78828729 CTTCAGTAACAGATGGAGAATGG + Intronic
1152217231 17:79040786-79040808 CCTCAGCCTCACAAGTAGAAGGG - Intronic
1152917872 17:83051437-83051459 CTTCAAAATCAGAACGAGGAAGG + Intronic
1154261005 18:12832762-12832784 CTTTAGAATCACCAGTGGAATGG - Intronic
1155872459 18:31044261-31044283 CCTCAGAAACTCAAGTAGAATGG + Intergenic
1156400276 18:36733395-36733417 CTTCAGATTCATACGGAGAGAGG + Intronic
1157125062 18:44948809-44948831 CTACAAAACCACAATGAGAATGG - Intronic
1157562363 18:48657491-48657513 CATCAGAATCACTGAGAGAAGGG - Intronic
1158496446 18:57959414-57959436 ATTCAGAATCACAGCCAGAAGGG + Intergenic
1158914183 18:62103790-62103812 TTTGAGAATCCTAAGGAGAAAGG + Intronic
1160149524 18:76388494-76388516 TTTCAGATCCACAAGGAGGAAGG + Intronic
1160255595 18:77245911-77245933 CTTCAGAAGCTCAACAAGAAGGG + Intergenic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
1163087943 19:14996293-14996315 CTGCAGAGTTGCAAGGAGAATGG + Intronic
1163704263 19:18803229-18803251 CTTAAGCATCACAAGGAAACAGG + Intergenic
1164685125 19:30161460-30161482 CTTCAGAACCACAGGGACCAGGG + Intergenic
1167596887 19:50432651-50432673 CTCCAGAATCTCAGGGAGGAGGG - Intergenic
1168599931 19:57709230-57709252 CTTGAGAGTCACAAAAAGAAAGG - Intronic
926559818 2:14403716-14403738 TTTCATAATAAGAAGGAGAAGGG + Intergenic
927679317 2:25129621-25129643 CTTCAGAAGGAAAAGGAGATGGG - Intronic
930952616 2:57161663-57161685 CTTCAGGATGTCAAGGAGACTGG + Intergenic
931642146 2:64391415-64391437 CTTTAAACTCACAATGAGAAGGG + Intergenic
933142383 2:78808747-78808769 CTTGAAAATAAAAAGGAGAAGGG + Intergenic
933343341 2:81050274-81050296 CTTTAGTATCACAATGTGAAAGG - Intergenic
933555388 2:83824299-83824321 CTTAAGAAGCATAAGGGGAAAGG - Intergenic
933916004 2:86994211-86994233 CTTCAGAATCACCTGGAGTAAGG + Intronic
933987877 2:87607880-87607902 CTTAAGATCCACAATGAGAAAGG - Intergenic
934006989 2:87775691-87775713 CTTCAGAATCACCTGGAGTAAGG - Intronic
935068203 2:99670187-99670209 CTTCAGGATCACAAAGGCAATGG + Intronic
935480484 2:103581912-103581934 TGTCTGAATCACAAGAAGAATGG - Intergenic
935501023 2:103838946-103838968 CTTCAACTTCATAAGGAGAAGGG - Intergenic
935770632 2:106416597-106416619 CTTCAGAATCACCTGGAGTAAGG - Intronic
935909454 2:107879338-107879360 CTTCAGAATCACCTGGAGTAAGG + Intronic
935967585 2:108496340-108496362 CTTCAGAATCACCTGGAGTAAGG + Intronic
936111918 2:109671543-109671565 CTCCAGATTCTCCAGGAGAAGGG - Intergenic
936131231 2:109844474-109844496 CTTCAGAATCACCTGGAGTAAGG + Intronic
936213466 2:110527011-110527033 CTTCAGAATCACCTGGAGTAAGG - Intronic
936305964 2:111342928-111342950 CTTAAGATCCACAATGAGAAAGG + Intergenic
936422604 2:112381570-112381592 CTTCAGAATCACCTGGAGTAAGG - Intronic
936798103 2:116231501-116231523 CTTCAGACTCCCAAGTAGATGGG - Intergenic
937742495 2:125373046-125373068 CTTCAGAAATACAATGAGCAGGG - Intergenic
938317659 2:130341201-130341223 CATCTGAATCACAAGGGGAAAGG - Intronic
938713393 2:133995318-133995340 CTTCAAAATCACAATGAGGTAGG + Intergenic
939959576 2:148554436-148554458 CATCAGAATCACTTGGAGGAGGG - Intergenic
942715271 2:178884600-178884622 CTTCAGTATTTAAAGGAGAAAGG - Intronic
942753702 2:179316017-179316039 CTTGAAAATGACAGGGAGAATGG + Intergenic
942771663 2:179528273-179528295 CATCATAATCCCAAGAAGAAAGG + Intronic
943614103 2:190072023-190072045 CTGCAGAACTGCAAGGAGAAAGG + Intronic
944436413 2:199695180-199695202 CTTCAAAATCACAAGACAAAGGG + Intergenic
944601682 2:201309603-201309625 CTTCAATAGCACAAGAAGAAAGG + Intronic
945411637 2:209516268-209516290 CTTCAGAATGATAAAGAGAGTGG + Intronic
946519820 2:220452341-220452363 TTTCAGAATCATAAGGAACATGG + Intergenic
947408749 2:229811046-229811068 CTTCACAAACACAAGAATAAAGG + Intronic
947475312 2:230441977-230441999 ATTCACAATGACAAAGAGAATGG - Intronic
1169389234 20:5176045-5176067 ATTCAGAGTCAAAAGGAGAATGG + Intronic
1169813452 20:9632079-9632101 CTTCTAAATCAAAAGAAGAAAGG - Intronic
1170568853 20:17621736-17621758 CTGCAGGATCTCAAAGAGAAAGG - Exonic
1170943061 20:20865134-20865156 CTTCAGCATCCCAAGGAGCTGGG + Intergenic
1171040038 20:21754488-21754510 CGTCAGTCTCTCAAGGAGAAAGG + Intergenic
1171521864 20:25782246-25782268 CTACAGCAACACAAGGAGACAGG + Intronic
1171554961 20:26073637-26073659 CTACAGCAACACAAGGAGACAGG - Intergenic
1173011009 20:39182096-39182118 CTTCAAAATCGAAATGAGAAAGG + Intergenic
1173549296 20:43921277-43921299 CTACAGAATCACATGGGGCAAGG - Intronic
1174638337 20:52021109-52021131 CTTCAGATTCCAAAGGACAATGG + Intergenic
1174754778 20:53146928-53146950 CTTCAGAATTATAAGGTCAATGG - Intronic
1176655668 21:9587243-9587265 CTACAGCAACACAAGGAGACAGG + Intergenic
1178661673 21:34511834-34511856 CTGCAGAAGCACATGGAGAAGGG - Intergenic
1179589241 21:42395160-42395182 CTGCAGAATCTCAGGGAGAAGGG - Intronic
1180631715 22:17234454-17234476 TTTCATCATCACAAGGAGAGGGG - Intergenic
1180923598 22:19536644-19536666 CTTCAGCCTCACAAGGAGCTGGG + Intergenic
1181024848 22:20122340-20122362 CTCCTGAAGCACAAGGAGAAAGG + Exonic
1181623953 22:24109666-24109688 CTTGGGGAACACAAGGAGAAAGG - Intronic
1181870368 22:25893565-25893587 CCTCACAATCACAAGCAGCATGG - Intronic
1182529184 22:30942049-30942071 CTCCAGAATCACAAGTAGTGTGG - Intronic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1184474959 22:44715386-44715408 CTCCTGAATAACAAGGGGAAGGG - Intronic
949878108 3:8640113-8640135 TTTCAGATTTACAAGGTGAAAGG + Intronic
951167413 3:19499322-19499344 CCTGAAAGTCACAAGGAGAATGG + Intronic
951175553 3:19594869-19594891 CCTGAAAGTCACAAGGAGAATGG - Intergenic
951472755 3:23073652-23073674 CATCAGAATCAAGTGGAGAAAGG - Intergenic
953237768 3:41121098-41121120 CGCCAGAATCACTTGGAGAATGG - Intergenic
954086801 3:48251095-48251117 ATTAAGATTCACAGGGAGAATGG - Intronic
954633678 3:52060017-52060039 CCTCAGAACCACACAGAGAAGGG + Intergenic
955069896 3:55563611-55563633 CTTCAGAATCCAAAGCAGAAAGG + Intronic
955290039 3:57683783-57683805 CTTCAGAATCAAAAGGACCAGGG + Intronic
955473461 3:59311829-59311851 CCTCAGAATCAGCAGGAGACTGG + Intergenic
955713769 3:61807165-61807187 CTTGTAAATCACAAGGAGAGAGG + Intronic
955863222 3:63354580-63354602 CTTCAAACTCACAAGGCAAAGGG + Intronic
956728872 3:72178358-72178380 CTTGAGAATCACCTGGGGAAGGG + Intergenic
956986650 3:74709018-74709040 CTTCAGCATCACAAGTAGATGGG + Intergenic
958737875 3:98030696-98030718 TTCTAGAATGACAAGGAGAATGG - Intronic
959019039 3:101168426-101168448 TCTCAGGATCCCAAGGAGAATGG + Intergenic
959647546 3:108720899-108720921 CTTCAGAATAATAATAAGAAAGG + Intergenic
959677266 3:109050409-109050431 CTTGAACATCACATGGAGAAGGG + Intronic
961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG + Intronic
961553378 3:127681304-127681326 CTTCAGAGGGCCAAGGAGAAAGG - Intergenic
962415934 3:135182005-135182027 ATTCTGAATTACAAGGAGATGGG - Intronic
964554595 3:157922409-157922431 ATTCAGAATCACAAACTGAAAGG - Intergenic
966104332 3:176317768-176317790 CTACAAAATCAAAAGCAGAATGG - Intergenic
966159552 3:176953576-176953598 CATCAGAATCTCAAGGGGTAGGG + Intergenic
966389782 3:179439785-179439807 CTTCAGTATTTAAAGGAGAAAGG - Intronic
966434779 3:179870952-179870974 TTTCAGAATCACAAAGAAAATGG - Intronic
966802195 3:183774696-183774718 CCTCTGAATCAGAAGTAGAAGGG + Intronic
968074158 3:195807135-195807157 CTTCAGAGTCTCCAGGAAAAGGG + Intronic
968427424 4:533095-533117 ATCCAGAATCACTAGGAGCAGGG + Intronic
969172918 4:5378358-5378380 CTTCAGAATCTCTAGGAGCTTGG - Intronic
969242983 4:5913486-5913508 CTTCCTAATCACATGGGGAATGG + Intronic
969940244 4:10724835-10724857 CTGCTGGATCACTAGGAGAAGGG - Intergenic
970434879 4:16023617-16023639 CTACAGACTCACCAGGAGCATGG + Intronic
970716123 4:18926063-18926085 CTTCAGAACATCAAGGAGAAAGG + Intergenic
971850271 4:31976763-31976785 GTTCAGATTCACAAAGAGAATGG - Intergenic
972163511 4:36254428-36254450 CTACAGAAAAATAAGGAGAAGGG + Intergenic
972351304 4:38238566-38238588 TTTCTGAACCTCAAGGAGAAAGG + Intergenic
972693143 4:41419508-41419530 CATAAGCTTCACAAGGAGAAAGG - Intronic
972803346 4:42500967-42500989 TATCATAATCACTAGGAGAAAGG + Intronic
973176680 4:47214485-47214507 CTACAAAGTCACAAGGAGAGTGG - Intronic
973334710 4:48944413-48944435 ATCCAGGCTCACAAGGAGAAAGG - Intergenic
976633955 4:87268658-87268680 CTTCAGATTCAGATTGAGAAGGG + Intergenic
976895695 4:90108385-90108407 CTTCAGAATCCCAAAGAGCTGGG - Intergenic
978218386 4:106237405-106237427 CTTCAAAATCATAAGCAGGAAGG + Intronic
980121857 4:128735598-128735620 CTTAAGACTCACAATCAGAAAGG + Intergenic
980144689 4:128967278-128967300 ATTCACAATAACAAGGAGATAGG - Intronic
981422090 4:144562655-144562677 CTTCAGACCAACAAGGAAAAGGG + Intergenic
981676839 4:147352259-147352281 ATTCAGAATGAGAAAGAGAAGGG - Intergenic
982772930 4:159414733-159414755 CTTCAGACCCACAATCAGAAAGG - Intergenic
983535124 4:168849428-168849450 CTGCAGAAGAAAAAGGAGAAAGG + Intronic
983721907 4:170865689-170865711 CCTCAGAAACACAGGGAGCAAGG - Intergenic
984116134 4:175683342-175683364 TTTCAGGCTCACAAGTAGAAGGG + Intronic
986830827 5:11575840-11575862 TATAAGAATCACAAGGAGAATGG - Intronic
987027874 5:13946001-13946023 CTTCAGCACCACACAGAGAAGGG - Intergenic
989227248 5:39043584-39043606 TTTCAAAATAACTAGGAGAAAGG + Intronic
989791429 5:45407224-45407246 CTACAGGATCACTAGGAGATAGG - Intronic
990552789 5:56900836-56900858 CTTAAGTCTCACAAGGTGAATGG + Intergenic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
992588873 5:78272463-78272485 CTTCAGAATCTAAAGGAGGAGGG - Intronic
993102545 5:83558733-83558755 CATCAGAATCTCAAGAATAAGGG - Intronic
993947242 5:94130552-94130574 CTTCACAAAAACAATGAGAATGG + Intergenic
996882509 5:128315857-128315879 CTTCAGAATCAGCAAGTGAAAGG - Intronic
999245899 5:150154627-150154649 CTTTAGAATGGCATGGAGAAGGG + Intronic
999713373 5:154338717-154338739 TTTCACAATGACAAGGGGAAGGG - Intronic
1000207305 5:159074810-159074832 CCTCTGAATCAGAAGGTGAAAGG - Intronic
1000473495 5:161676161-161676183 TTACAGAAGCACAAGCAGAATGG - Intronic
1001182441 5:169533183-169533205 CTTCAGCATCCCAAGGAGCTGGG + Intergenic
1001489656 5:172146439-172146461 CTCAAGAAACACAAGGAAAACGG + Intronic
1001514764 5:172347626-172347648 CTTCAGAATAACACAGAGATGGG + Intronic
1002083279 5:176750132-176750154 CTTCAGAAGGGGAAGGAGAAAGG + Intergenic
1002950703 6:1807817-1807839 CTTCATAATCATAAGGATTAAGG + Intronic
1003090300 6:3096453-3096475 CTTCCGAATCACAAAGTAAATGG - Intronic
1003297478 6:4844571-4844593 CTTCAGAGTCACAAGGAAAATGG - Intronic
1005227840 6:23663589-23663611 CATCAGAATAACACAGAGAAGGG - Intergenic
1007296434 6:40825425-40825447 CTGCAGAATCACAAGCATACCGG - Intergenic
1007489920 6:42212196-42212218 CTTCAAATTCACAATGAAAAAGG + Intronic
1008440329 6:51525440-51525462 ATTCAGAATGAGAAAGAGAAGGG + Intergenic
1008845913 6:55964015-55964037 CTTCAGAATCAGAAGGTGGCAGG - Intergenic
1009055406 6:58328755-58328777 CTTCATTATCACAGGGAGAATGG - Intergenic
1009235759 6:61121827-61121849 CTTCATTATCACAGGGAGAATGG + Intergenic
1009596297 6:65740997-65741019 TCTCAGAATCACAAGAACAAGGG + Intergenic
1012324544 6:97899640-97899662 CATCACGAACACAAGGAGAATGG - Intergenic
1012444559 6:99294513-99294535 CTTCAGGACCACTATGAGAAGGG + Intronic
1013599737 6:111692738-111692760 CCTCAGACTCAGAAGGAGAGTGG - Intronic
1014471753 6:121823821-121823843 CTTAAGTAACACAAGTAGAAAGG + Intergenic
1014558104 6:122857270-122857292 CCTCAGAAAAATAAGGAGAAAGG - Intergenic
1014836407 6:126165891-126165913 CCTCAAAATGACAGGGAGAAAGG - Intergenic
1014874901 6:126645431-126645453 TTTCAAAATCAAAAGAAGAAAGG - Intergenic
1015627809 6:135199398-135199420 CTTCAGAATAAGAACGAGTATGG + Intronic
1016159141 6:140855352-140855374 CTTCAGGATGAAAAGAAGAAAGG - Intergenic
1016714551 6:147209782-147209804 ATTCAGAATGACAGGGAGGAAGG + Intronic
1016884351 6:148945427-148945449 CCCCAGAATCTCCAGGAGAAGGG - Intronic
1017415960 6:154220960-154220982 AATCAGCATCACAAGGAGAGAGG - Intronic
1017967927 6:159282508-159282530 ATTCAGCATCAAAAAGAGAAAGG - Intergenic
1020731064 7:11881264-11881286 CCTCAGAAGCAGTAGGAGAATGG + Intergenic
1020825057 7:13016674-13016696 CTTCCGTATCACAAGGACAGGGG - Intergenic
1020863617 7:13526734-13526756 CATCAGAATCACATGGAGGCTGG - Intergenic
1021951471 7:25779102-25779124 CATCAGAATCACTGGGGGAAAGG + Intergenic
1022387836 7:29918144-29918166 CTTCAGAGTCACATTGAGCATGG + Intergenic
1023117078 7:36872996-36873018 CTTCAGAATCTCTAATAGAAAGG + Intronic
1024391385 7:48816808-48816830 CTTGAGAATGACAAAGGGAAAGG + Intergenic
1024773770 7:52758225-52758247 CTTGAGAATTACAAGAAAAATGG - Intergenic
1025282357 7:57637428-57637450 CTACAGCAACACAAGGAGACAGG + Intergenic
1025302372 7:57828091-57828113 CTACAGCAACACAAGGAGACAGG - Intergenic
1025843903 7:65178453-65178475 CTTTAGTATCACAAGGACTATGG - Intergenic
1025894236 7:65684764-65684786 CTTTAGTATCACAAGGACTATGG - Intergenic
1027799140 7:82730666-82730688 CTCCTGAATCACATGGAGAAGGG + Intergenic
1027842204 7:83327070-83327092 TTTCAGAATCACAACAAGATAGG + Intergenic
1028577221 7:92365691-92365713 CTTCAGAATGACCAGGTGAGAGG + Intronic
1029015534 7:97312095-97312117 CTTCAAAATCTCAAGCAAAATGG - Intergenic
1029848529 7:103439166-103439188 CTTCAGGGCAACAAGGAGAAAGG + Intronic
1030209304 7:106980748-106980770 TTTCAAAATCACAAAGAAAAGGG + Intergenic
1030956195 7:115855762-115855784 CATCAGAATCTCAAGGGGCAGGG + Intergenic
1033243706 7:139701787-139701809 CTTGAGTTTCACAAGGGGAATGG + Intronic
1033772057 7:144563873-144563895 CTAAATAATCTCAAGGAGAAGGG - Intronic
1035615347 8:995986-996008 CTTCAGAACCACATGGAAAAGGG - Intergenic
1036486440 8:9183828-9183850 CCCCAGAATCACTAGGCGAAGGG - Intergenic
1038715970 8:29991528-29991550 CTTCTCAGTCACAAGGTGAATGG + Intergenic
1039380052 8:37076556-37076578 CTTCTGAATCAAATGGTGAAAGG - Intergenic
1039817029 8:41103274-41103296 TTACAGAATATCAAGGAGAAGGG + Intergenic
1039960855 8:42246651-42246673 CTGCAGAATCTCAGAGAGAAGGG + Intergenic
1040730303 8:50437869-50437891 CTTCAAAATCACAAAGATGATGG - Intronic
1041589616 8:59561880-59561902 CATAAAAATCACAAGAAGAAGGG + Intergenic
1041821314 8:62036874-62036896 CCTCAGACTCACAAGTAGATGGG - Intergenic
1042691799 8:71508118-71508140 GTGCAGAAGCACAAGGACAAAGG - Intronic
1043288846 8:78570246-78570268 CTTCTGAAACATAAAGAGAAAGG + Intronic
1044103271 8:88168245-88168267 CTTCTGAATAAGAAAGAGAAAGG + Intronic
1044445042 8:92265544-92265566 CTTAAGAACCACAATCAGAAAGG + Intergenic
1045606118 8:103778910-103778932 CTTCAAAAAGACAAGGATAAGGG - Intronic
1045778397 8:105834391-105834413 CTTGAGACTCTCAGGGAGAAGGG + Intergenic
1045991523 8:108314349-108314371 CTTAAGATTCACAATCAGAAAGG - Intronic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047478047 8:125254433-125254455 CTTCAGAATCTGAATGAGCATGG - Intronic
1052950180 9:34202443-34202465 CTTAAGACTCACAATGAGAAAGG + Intronic
1054740127 9:68797690-68797712 CTACAGATTCACAAAGAGATTGG + Intronic
1054973540 9:71116678-71116700 CTTCTGTATCACAAAGAGAAAGG + Intronic
1055925385 9:81504896-81504918 CTTCAGTATCACAAGGAGCTGGG + Intergenic
1056718203 9:89051116-89051138 CTTCATAATCATAAGAACAAAGG + Intronic
1056974810 9:91242614-91242636 ATTCAGAAACACAAGAAAAACGG - Intronic
1058281229 9:103117309-103117331 CTACAGTATCACTAGGAGATAGG - Intergenic
1058430545 9:104914684-104914706 CTCCACAATCACATGTAGAATGG + Intronic
1059325408 9:113501352-113501374 CCTCAGAATGACAAGGAAGAGGG - Intronic
1060566686 9:124599045-124599067 CTCCTGAAGCACAAGGAGAAGGG - Intronic
1060898102 9:127232260-127232282 CTTCAGTAGCTGAAGGAGAAGGG - Intronic
1203633383 Un_KI270750v1:90704-90726 CTACAGCAACACAAGGAGACAGG + Intergenic
1187301847 X:18058616-18058638 CTTTAGACTCACAAGGGTAAGGG + Intergenic
1188064819 X:25646077-25646099 CTCCTGAAGCACAAGGAGAAAGG - Intergenic
1188596933 X:31912828-31912850 GTTCAGAATCAAAATGAGAAGGG - Intronic
1190503560 X:51102862-51102884 CTTCATAATGAGAGGGAGAATGG + Intergenic
1193048468 X:77077403-77077425 CTTGAGAACCACATGGGGAAGGG - Intergenic
1194284080 X:91988296-91988318 CTTCAGTATGAGGAGGAGAAGGG - Intronic
1194473507 X:94328994-94329016 TTTCAAAATAACCAGGAGAATGG + Intergenic
1196921396 X:120589257-120589279 TTTCAAAATAACAAGAAGAAAGG + Intergenic
1198185319 X:134248808-134248830 CTTCAGAGGGCCAAGGAGAAAGG + Intergenic
1198409800 X:136355023-136355045 CTTAAGACTCACAATCAGAAAGG + Intronic
1199491638 X:148406374-148406396 CATCAGAATCACAAGAAAGAAGG - Intergenic
1201380555 Y:13372887-13372909 CTTCACAATCACCAGGATGAAGG + Intronic
1202075359 Y:21031950-21031972 CTTGAGAACCACAGGGAGCAGGG - Intergenic