ID: 908004167

View in Genome Browser
Species Human (GRCh38)
Location 1:59711284-59711306
Sequence CCTGTCAAGCAGTCGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1049
Summary {0: 1, 1: 0, 2: 7, 3: 90, 4: 951}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
908004167 Original CRISPR CCTGTCAAGCAGTCGGGGGA AGG Intronic
900150692 1:1178074-1178096 CCTGTCACTCAGGCGGGGCAGGG + Intronic
901065271 1:6491299-6491321 CCTGGGAAGGGGTCGGGGGAAGG - Intronic
901789745 1:11647936-11647958 CCTTCCAAGCAGCTGGGGGAGGG + Intergenic
903141551 1:21342257-21342279 CCTGGCAGACAGTTGGGGGAAGG - Intronic
905259387 1:36706707-36706729 CCTGCCGAGCAATCGGGGAAGGG + Intergenic
905757932 1:40527493-40527515 CCTGTTATGGAGTGGGGGGAAGG + Intergenic
906009823 1:42512671-42512693 CCAGTCAAGCAGTCAGAGGCTGG + Intronic
906442174 1:45857748-45857770 CCTGTCATGGAGTCGGGGGAGGG - Intronic
906722771 1:48021278-48021300 CCTGTCATGGGGTCGGGGGAGGG + Intergenic
906766643 1:48440187-48440209 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
906939162 1:50240646-50240668 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
907016774 1:51023227-51023249 CCTGTCATGGGGTGGGGGGATGG - Intergenic
907842305 1:58169835-58169857 CCCTTCAAGCTGTAGGGGGAAGG + Intronic
908004167 1:59711284-59711306 CCTGTCAAGCAGTCGGGGGAAGG + Intronic
908069271 1:60440526-60440548 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
908659795 1:66423897-66423919 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
908821133 1:68087744-68087766 CCTGTCATGGGGTGGGGGGATGG - Intergenic
908895713 1:68896045-68896067 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
909087609 1:71186355-71186377 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
909318318 1:74251728-74251750 ACTCTCTAGCAGTTGGGGGAGGG - Intronic
909449633 1:75784270-75784292 CCTGTCATGGTGTTGGGGGAGGG + Intronic
910090015 1:83451232-83451254 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
910191977 1:84604226-84604248 CCAGTCAGGCAGTCGGAGGCTGG - Intergenic
910739056 1:90495013-90495035 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
910942356 1:92550340-92550362 CCTGTCATGGGGTGGGGGGAGGG + Intronic
911174128 1:94802374-94802396 TCTGGCAAGCAGTTGGGAGAGGG + Intergenic
911212643 1:95158656-95158678 CCTGTCATGGGGTGGGGGGAGGG - Intronic
911298931 1:96150107-96150129 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
911433631 1:97825614-97825636 CCTGTCATGGGGTGGGGGGAGGG + Intronic
911649908 1:100376145-100376167 CCTGTCATGGGGTGGGGGGATGG + Intronic
911686008 1:100778464-100778486 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
911767189 1:101691982-101692004 CCTGTCAGGGTGTCGGGGGATGG - Intergenic
912021261 1:105111219-105111241 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
912126511 1:106545756-106545778 CCTGTCATGGGGTGGGGGGATGG - Intergenic
912384063 1:109262605-109262627 CCTGTGGGGCAGTCTGGGGAGGG + Intronic
912583617 1:110741790-110741812 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
912594515 1:110860642-110860664 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
912616211 1:111102399-111102421 CCTGGCCAGAACTCGGGGGAAGG - Intergenic
912846281 1:113077883-113077905 CCTGTCATGGGGTGGGGGGAGGG - Intronic
913261382 1:117000990-117001012 CCTGTCATAGGGTCGGGGGAAGG + Intergenic
913710977 1:121483106-121483128 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
913962385 1:143350410-143350432 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
913995397 1:143648253-143648275 CCTGTCATGAGGTGGGGGGAGGG + Intergenic
914056740 1:144175986-144176008 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
914122406 1:144790376-144790398 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
915187631 1:154120470-154120492 CCTGTCATGGGGTTGGGGGAGGG + Intronic
915260527 1:154673686-154673708 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
915851750 1:159331755-159331777 CCTGTCATGGAGTGAGGGGAGGG - Intergenic
916083591 1:161252325-161252347 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
916643864 1:166762447-166762469 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
916939490 1:169664207-169664229 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
917057943 1:171004241-171004263 CCTGGCCAGAACTCGGGGGAGGG - Intronic
917129310 1:171724316-171724338 CCTGTCATGGGGTGGGGGGAGGG + Intronic
917141798 1:171842091-171842113 CCAGTCGGGGAGTCGGGGGAGGG + Intronic
917279846 1:173370047-173370069 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
917445837 1:175105319-175105341 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
917676241 1:177321812-177321834 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
917803528 1:178592944-178592966 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
918137651 1:181689129-181689151 CCTGTCAAGGAATCAGGGGGCGG - Intronic
918325034 1:183401913-183401935 CCTGTCATGGGGTTGGGGGAGGG + Intronic
918403133 1:184184585-184184607 CCTGTCATGGGGTGGGGGGATGG - Intergenic
918661802 1:187097875-187097897 CCTGTCATGAGGTGGGGGGAAGG - Intergenic
918713135 1:187756681-187756703 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
918816379 1:189190903-189190925 CCTGTCATGGGGTGGGGGGATGG - Intergenic
919048799 1:192487092-192487114 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
919309629 1:195891839-195891861 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
919558616 1:199092455-199092477 CCCTTCAAGCTGTTGGGGGATGG + Intergenic
919742323 1:200988584-200988606 CCTGTCCAAGTGTCGGGGGAGGG + Intronic
920342053 1:205281414-205281436 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
921019664 1:211224384-211224406 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
921239231 1:213160842-213160864 CCTGTCATGGGGTGGGGGGATGG + Intronic
921925719 1:220708547-220708569 CCTGTCAGGGAGTGGGGGCAAGG + Intergenic
922611197 1:226930083-226930105 CCTGTCATGGGGTGGGGGGAGGG + Intronic
923620265 1:235573317-235573339 CCTGTCAAGGGGTGGGGGGAGGG + Intronic
923968092 1:239166314-239166336 CCTGTCATGGGGTGGGGGGATGG + Intergenic
924249909 1:242121934-242121956 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1062935549 10:1383539-1383561 CATATCAAGCATTCTGGGGAAGG - Intronic
1063547950 10:7000475-7000497 CCTGTCGTGGAGTGGGGGGATGG + Intergenic
1063570800 10:7213073-7213095 CCTGTCAAGGGGTGGGGGTAAGG + Intronic
1063581507 10:7312070-7312092 CCTGTCGTGGAGTGGGGGGAGGG + Intronic
1063697103 10:8347607-8347629 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
1063747857 10:8906027-8906049 CCTGTCAGGGGGTCGGGGGTAGG + Intergenic
1063859121 10:10289522-10289544 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1064452890 10:15459357-15459379 TCTGTGAAGCAGTATGGGGAGGG - Intergenic
1064695977 10:17965621-17965643 TCTGTAAAGTAGTCTGGGGAAGG - Exonic
1065082377 10:22140993-22141015 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1065161244 10:22924693-22924715 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1065192801 10:23229426-23229448 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1065414628 10:25471106-25471128 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1065450994 10:25856761-25856783 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1065649268 10:27870502-27870524 CCTGTCATGGGGTTGGGGGATGG - Intronic
1065992561 10:31027085-31027107 CCTGTCGTGGGGTCGGGGGAGGG + Intronic
1066009330 10:31179881-31179903 CCTGTTTAGCAGTAGGGAGATGG + Intergenic
1066483201 10:35817463-35817485 CCTGTCATGGAGTGGGGGGAGGG + Intergenic
1066614606 10:37282434-37282456 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1066701394 10:38133463-38133485 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1066714006 10:38266827-38266849 CCTGTCAAGGGGTTGGGGGCTGG + Intergenic
1066751795 10:38665168-38665190 CCTGTCATGGAGTGGGGGGAGGG + Intergenic
1066965245 10:42257923-42257945 CCTGTCATGGAGTGGGGGGAGGG - Intergenic
1067017025 10:42765266-42765288 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1068215169 10:53973284-53973306 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1068249891 10:54424852-54424874 CCCGTCAAGCGGTGGGGGGAGGG + Intronic
1068491808 10:57734046-57734068 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1068500278 10:57834877-57834899 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1068575704 10:58682015-58682037 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1068641047 10:59408473-59408495 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1069137369 10:64782622-64782644 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1069198745 10:65587255-65587277 GCTGTCATGGGGTCGGGGGAGGG - Intergenic
1069354206 10:67564486-67564508 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1069365121 10:67688238-67688260 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1070584224 10:77748936-77748958 CCTGTGAAGCAGCCAGGGCAAGG - Intergenic
1070852403 10:79576321-79576343 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
1071173336 10:82894893-82894915 CCTGTCGGGCAGTGGGGGCAAGG - Intronic
1071204479 10:83258179-83258201 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1071825528 10:89322062-89322084 CCTGTCATGGGGTAGGGGGAGGG + Intronic
1071834825 10:89408561-89408583 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
1072346879 10:94516565-94516587 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1072407102 10:95165408-95165430 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1073970723 10:109043467-109043489 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1074035130 10:109731205-109731227 CCTGTCATGCGGTGGGGGGATGG - Intergenic
1074053560 10:109901253-109901275 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1075296318 10:121278782-121278804 CCTGTCAGGGGGTGGGGGGAAGG + Intergenic
1075858601 10:125653480-125653502 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1075904131 10:126065848-126065870 CCTGGAAGGGAGTCGGGGGAAGG - Intronic
1075994302 10:126864564-126864586 CCTGTCAAGGGGTGGGGGGAGGG + Intergenic
1076024010 10:127097627-127097649 TCTGTCCACCAGTGGGGGGACGG - Intronic
1077969128 11:7169359-7169381 CCTGTCAGGAGGTGGGGGGAAGG - Intergenic
1078461911 11:11520792-11520814 CCTGTGGATCAGTCCGGGGAGGG + Intronic
1079465583 11:20726744-20726766 CCTGTCATGGGGTGGGGGGATGG - Intronic
1079482744 11:20898413-20898435 CCTGTCATGGGGTGGGGGGAAGG + Intronic
1079731249 11:23939392-23939414 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1079813567 11:25026135-25026157 CCTGTCATGGGGTAGGGGGAGGG + Intronic
1079824444 11:25173978-25174000 CCTGTCGGGCAGTAAGGGGAGGG - Intergenic
1080009846 11:27447028-27447050 CCTGTCATGGGGTCAGGGGAGGG + Intronic
1080031986 11:27671150-27671172 CCTGTCATGGAGTAGGGGTAGGG + Intronic
1080137855 11:28878853-28878875 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1080175244 11:29355573-29355595 CCTGTCATGGGGTTGGGGGAAGG - Intergenic
1080181185 11:29428472-29428494 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1080366479 11:31579778-31579800 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1080482013 11:32661448-32661470 CCTGTCATGGGGTTGGGGGAGGG - Intronic
1081421396 11:42877159-42877181 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1082049165 11:47756692-47756714 CCTGTCATGGGGTCGGGGGTGGG - Intronic
1082098506 11:48151595-48151617 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1082165898 11:48950264-48950286 CCTGTCCAGCAGTCCAGTGATGG - Intergenic
1082241387 11:49875006-49875028 CCTGTCCAGCAGTCCAGTGATGG - Intergenic
1082563637 11:54649214-54649236 CCTGACAAGCAATCAGGGAAAGG - Intergenic
1082567731 11:54700652-54700674 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1082716563 11:56620849-56620871 CCTGTCAGGGGGTCGGGGGCTGG + Intergenic
1083502831 11:63127126-63127148 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
1083509841 11:63198561-63198583 CCTGTCATGAGGTTGGGGGATGG + Intronic
1083525403 11:63360445-63360467 CCTGTCATGCAGTGGAGGGATGG - Intronic
1084654438 11:70506862-70506884 CCTGGCAAGCACTTGGGGGCAGG + Intronic
1086457986 11:86978044-86978066 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1086498439 11:87427451-87427473 CCTGTCGTGCAGTGGGGGGAGGG - Intergenic
1086697037 11:89859539-89859561 CCTGTCCAGCAGTCCAGTGATGG - Intergenic
1086709121 11:89984948-89984970 CCTGTCCAGCAGTCCAGTGATGG + Intergenic
1086827736 11:91519866-91519888 CCTGTCGTGGGGTCGGGGGAAGG - Intergenic
1087110714 11:94463774-94463796 CCTGTCATGGGGTTGGGGGAGGG + Intronic
1087356639 11:97102185-97102207 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1087683355 11:101238476-101238498 CCATTCAAGCTGTAGGGGGAGGG - Intergenic
1087982107 11:104628328-104628350 CCTGTCATAGTGTCGGGGGAGGG - Intergenic
1088122577 11:106387495-106387517 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1088239466 11:107758686-107758708 CCTGGCCAGAACTCGGGGGAGGG + Intergenic
1088361217 11:108992072-108992094 CCTGGCAAGCAGTCGAGTGCTGG - Intergenic
1088388097 11:109281919-109281941 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1088492517 11:110401570-110401592 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1088679284 11:112225714-112225736 CCTGTCAGGGAGTAGGGGGCTGG + Intergenic
1088983426 11:114884580-114884602 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1090359358 11:126161784-126161806 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1090687675 11:129141465-129141487 CCTGTCATGGGGTAGGGGGATGG + Intronic
1090723538 11:129499480-129499502 CCTGTCATGGGGTAGGGGGATGG + Intergenic
1090849509 11:130559911-130559933 CCTGTCATGTGGTGGGGGGAGGG + Intergenic
1090933257 11:131318509-131318531 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1091179296 11:133589144-133589166 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
1091573937 12:1714988-1715010 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1092325040 12:7522046-7522068 CCTGTCAGGCAGTGGGGTGGGGG - Intergenic
1092532341 12:9354956-9354978 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1092549395 12:9481631-9481653 CCTGTCATGCAGTGGGGAGAGGG + Intergenic
1092768499 12:11874889-11874911 CCTGTTATGGGGTCGGGGGAGGG + Intronic
1092847469 12:12596975-12596997 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
1092903717 12:13083683-13083705 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1092930952 12:13315187-13315209 ACTGTCAAGCAGTGGAGGTAGGG - Intergenic
1093128397 12:15358226-15358248 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1093172268 12:15874345-15874367 CCTGGCCAGAACTCGGGGGAGGG + Intronic
1093372271 12:18379357-18379379 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1093675136 12:21929981-21930003 CCTGTCATGAGGTAGGGGGAGGG - Intronic
1093802906 12:23394968-23394990 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
1094362049 12:29640768-29640790 CCTGGCCAGAACTCGGGGGAGGG + Intronic
1094382175 12:29854833-29854855 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1094405768 12:30114835-30114857 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1094521869 12:31199513-31199535 CCTGTCGTGCAGTGGGGAGAGGG - Intergenic
1095531051 12:43186996-43187018 CCTGTCATGAGGTAGGGGGAGGG - Intergenic
1095585577 12:43845690-43845712 CCTGTCATGGGGTTGGGGGAGGG - Intronic
1096598379 12:52712501-52712523 CCTGTCATGTGGTAGGGGGAGGG + Intergenic
1097428281 12:59473052-59473074 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1098826561 12:75305369-75305391 CCTCTCCAGGAGTCGGCGGAGGG + Intronic
1098864803 12:75749363-75749385 CCTGTCATGGGGTTGGGGGAAGG + Intergenic
1099342050 12:81449787-81449809 CCTGTCATGGGGTCGGGGGGAGG - Intronic
1099376228 12:81898619-81898641 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1099392987 12:82102944-82102966 CCTGGCAAGAACTCAGGGGAGGG + Intergenic
1099414763 12:82372273-82372295 CCCTTCAAGCTGTAGGGGGAAGG - Intronic
1099426772 12:82533008-82533030 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1099427730 12:82545330-82545352 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1099467693 12:83006931-83006953 CCTGTCATGGGGTCGGGGGCTGG + Intronic
1099484252 12:83208721-83208743 CCTGTCATGCGGTGGGGGGATGG - Intergenic
1099575682 12:84377952-84377974 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1099884048 12:88504963-88504985 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1100092126 12:90984831-90984853 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
1100166889 12:91926035-91926057 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1100472238 12:94903950-94903972 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1100530252 12:95455816-95455838 CCTTTCAAGCTGTAGGGGGAGGG - Intergenic
1100545453 12:95597814-95597836 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
1100706260 12:97203503-97203525 CCTGGCCAGAATTCGGGGGAGGG + Intergenic
1101054721 12:100900449-100900471 CCTGTCATGGGGTAGGGGGAGGG - Intronic
1101636380 12:106546065-106546087 CCTGTCGTGCGGTTGGGGGAGGG - Intronic
1101705084 12:107214093-107214115 CCTGTCATGGGGTCGGGGGAGGG + Intergenic
1101743307 12:107518596-107518618 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1101768690 12:107728096-107728118 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1101779641 12:107823904-107823926 CCCATCAAGCTGTAGGGGGAGGG + Intergenic
1102704247 12:114867511-114867533 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1103167199 12:118780001-118780023 CCTGTCGTGGGGTCGGGGGAGGG + Intergenic
1104073460 12:125369019-125369041 CCTGTCATGGGGCCGGGGGAGGG - Intronic
1104131877 12:125901976-125901998 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1104479447 12:129095025-129095047 CCTGTCGTGGGGTCGGGGGAGGG + Intronic
1105045060 12:132995990-132996012 TCTGTCATGCAGTAGGGGAATGG + Intronic
1105350606 13:19611898-19611920 CCTGTCATGGGGTTGGGGGAAGG - Intergenic
1105445438 13:20451053-20451075 CCTGTCGAGGGGTGGGGGGAGGG + Intronic
1105582590 13:21713618-21713640 CCTGTCATGGGGTCGGGGGAGGG + Intergenic
1105762464 13:23527020-23527042 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1106162671 13:27214902-27214924 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1106199709 13:27526156-27526178 CCTGTCAAGGAGTCAGATGATGG - Intergenic
1106327427 13:28707393-28707415 CCTGTCGTGGAGTGGGGGGAGGG + Intronic
1106649892 13:31679070-31679092 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1106824457 13:33504598-33504620 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1106831688 13:33590692-33590714 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1106932004 13:34676665-34676687 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1107324266 13:39224109-39224131 CCTGTCGAGGGGGCGGGGGAGGG + Intergenic
1107424414 13:40278729-40278751 CCTGTCGGGGAGTGGGGGGAGGG + Intergenic
1107457839 13:40571215-40571237 CCTGTCATGGGGTGGGGGGAAGG + Intronic
1107579327 13:41765300-41765322 CCTTTCCAGTAGTCTGGGGAGGG - Intronic
1107662759 13:42656369-42656391 CCTCTTAAGCAGCTGGGGGAGGG + Intergenic
1108476653 13:50826007-50826029 CCTGTCGTGGGGTCGGGGGAGGG - Intronic
1108547427 13:51509864-51509886 CCTGTCATGGGGTTGGGGGAAGG - Intergenic
1109279607 13:60340926-60340948 CCTGTCGTGGAGTGGGGGGATGG - Intergenic
1109465387 13:62725696-62725718 CCTGTCATGGAGTGGGGGCAGGG - Intergenic
1109538790 13:63745869-63745891 CCTGTCATGGAGTGGGGAGAGGG + Intergenic
1109545045 13:63833897-63833919 CCTGTCATGGAGTGGGGAGAGGG - Intergenic
1110130867 13:72008405-72008427 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1110151870 13:72265628-72265650 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
1110381355 13:74855012-74855034 CCTGTCGTGGGGTCGGGGGAGGG + Intergenic
1110791102 13:79587861-79587883 CCTGTCATGGGGTAGGGGGATGG - Intergenic
1110815696 13:79857960-79857982 CCTGTCAGGGGGTCGGGGGCCGG + Intergenic
1111566422 13:90023027-90023049 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1111707912 13:91774607-91774629 CATGTCCAGCAGTAGGGGGATGG - Intronic
1111722598 13:91965076-91965098 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1111771809 13:92606235-92606257 CCTGTCGTGGAGTTGGGGGAAGG - Intronic
1111792699 13:92878952-92878974 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1112347518 13:98602753-98602775 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1112519097 13:100080461-100080483 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1112538348 13:100282978-100283000 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
1112541545 13:100318479-100318501 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1112545172 13:100361122-100361144 ATTGCCAAGCATTCGGGGGAGGG + Intronic
1112650452 13:101390903-101390925 CCTGTCATGGGGTCGGGGGAGGG + Intronic
1112828362 13:103418460-103418482 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1112830213 13:103440563-103440585 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1113269993 13:108662767-108662789 CCTGGCCAGAACTCGGGGGAGGG - Intronic
1114433528 14:22683781-22683803 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
1114796169 14:25717674-25717696 CCTGTCATGGAGTAGGGGGATGG - Intergenic
1114904133 14:27103437-27103459 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1115040439 14:28918161-28918183 CCTGTCAAGGAGTGGGGGACTGG + Intergenic
1115285480 14:31709753-31709775 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1115477734 14:33832159-33832181 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1115728745 14:36245088-36245110 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1115750809 14:36487791-36487813 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1115936425 14:38558316-38558338 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1116194798 14:41710767-41710789 CCTGTCGTGGGGTCGGGGGACGG - Intronic
1116219167 14:42060189-42060211 CCTGTCATGGGGTCGGGGGAGGG - Intergenic
1116346647 14:43802939-43802961 CCTGGCCAGAACTCGGGGGAGGG + Intergenic
1116698328 14:48203792-48203814 CCTGTCAGGGGGTCGGGGGCTGG + Intergenic
1116726695 14:48570378-48570400 CCTGTCATGGAGTCGGGGGAGGG - Intergenic
1117112702 14:52475315-52475337 CCTGGCCAGAACTCGGGGGAGGG + Intronic
1117612491 14:57499150-57499172 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1117636197 14:57746076-57746098 CCTGTCATGGAGTGGGGGGCAGG + Intronic
1117893178 14:60449029-60449051 CCTGTCAGGGAGTAGGGGGCTGG + Intronic
1118803906 14:69217687-69217709 CCTGTCATGGAGTGGGGGGAGGG - Intronic
1119079269 14:71676623-71676645 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1119093942 14:71811526-71811548 CCTGTCATGGGGTGGGGGGACGG + Intergenic
1119280837 14:73406242-73406264 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1120349908 14:83342252-83342274 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1120462384 14:84813961-84813983 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
1120568286 14:86086234-86086256 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1120637498 14:86970073-86970095 CCTGTTATGGGGTCGGGGGAGGG + Intergenic
1120804405 14:88731217-88731239 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1121459796 14:94066009-94066031 CCTGGCCAGAACTCGGGGGAGGG + Intronic
1122084231 14:99288734-99288756 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1122357473 14:101132310-101132332 CCTGGCAAGCAGCCACGGGAGGG - Intergenic
1122832994 14:104412191-104412213 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1123411089 15:20060141-20060163 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1123520420 15:21066829-21066851 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1123687587 15:22810130-22810152 CCTGTCAAGAGGCAGGGGGAGGG + Intronic
1124058785 15:26267820-26267842 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1124380667 15:29162308-29162330 CCTGGCCAGAACTCGGGGGAGGG + Intronic
1124914375 15:33954645-33954667 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1124983912 15:34586681-34586703 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1125111885 15:36043783-36043805 CCTGTCAGAAGGTCGGGGGAGGG + Intergenic
1125167123 15:36720425-36720447 CCTGTCATAGGGTCGGGGGAGGG - Intronic
1126072094 15:44874232-44874254 CTTTTCAAGCTGTAGGGGGAGGG - Intergenic
1126541219 15:49826292-49826314 CCTGTCGAGGAGTGGGGGGCTGG - Intergenic
1126732855 15:51701928-51701950 CCTGTCGTGGGGTCGGGGGATGG + Intronic
1126855002 15:52829974-52829996 CCTGTCAAGGGGTGGGGGAATGG + Intergenic
1126856414 15:52843742-52843764 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1127057705 15:55149146-55149168 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1127970640 15:63957504-63957526 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1128122999 15:65168591-65168613 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1128720620 15:69945442-69945464 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1129092614 15:73167118-73167140 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1129867143 15:78917868-78917890 CCTGTCATGGAGTAGGGGCAGGG + Intergenic
1130124185 15:81079137-81079159 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130200770 15:81824534-81824556 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1130670867 15:85911394-85911416 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1131475961 15:92739609-92739631 CCTGTCGTGCAGTGGAGGGATGG + Intronic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1132096957 15:98993667-98993689 CCTGTCAGGCGGTGGGGGGTGGG + Intronic
1132144198 15:99417531-99417553 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1132439847 15:101849697-101849719 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1132685428 16:1160037-1160059 CCTGTCAAACACTCCGGGGATGG + Intronic
1133923568 16:10176692-10176714 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1134775280 16:16847755-16847777 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1135166570 16:20144393-20144415 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1135184597 16:20304507-20304529 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1135339698 16:21635268-21635290 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1135954003 16:26940508-26940530 CCTGTCAGGGGGTCGGGGGAGGG - Intergenic
1136730929 16:32411935-32411957 CCTGTCATGGAGTGGGGGGAGGG - Intergenic
1137454146 16:48605389-48605411 CCTGTGAAGCAGTGGTGGAAAGG - Intronic
1137460917 16:48662496-48662518 CCTGTCATGGGGTAGGGGGAAGG - Intergenic
1137867238 16:51912970-51912992 CCTGTCAGGCAGTTAGAGGAGGG + Intergenic
1138100414 16:54247717-54247739 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1138164689 16:54790102-54790124 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1138701952 16:58873287-58873309 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
1138710473 16:58965228-58965250 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1138749961 16:59408000-59408022 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1138752681 16:59443097-59443119 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1138812219 16:60164254-60164276 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1138891918 16:61154045-61154067 CCTGTCATGGGGTAGGGGGAAGG - Intergenic
1139650164 16:68358226-68358248 CCTGTCCTGCAGTTGGGGGCAGG + Exonic
1140150053 16:72353639-72353661 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1141038097 16:80645978-80646000 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1141061056 16:80870979-80871001 CCTGTCAGGGGGTTGGGGGAGGG - Intergenic
1202995465 16_KI270728v1_random:105335-105357 CCTGTCATGGAGTGGGGGGAGGG + Intergenic
1203022152 16_KI270728v1_random:417677-417699 CCTGTCATGGAGTGGGGGGAGGG + Intergenic
1142482031 17:224957-224979 CCTGTCATGGGGTTGGGGGAGGG + Intronic
1144222228 17:13110426-13110448 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1144382984 17:14721185-14721207 CCTGTCGTGGGGTCGGGGGAGGG + Intergenic
1145125344 17:20295168-20295190 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1145194855 17:20883014-20883036 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1145198477 17:20917592-20917614 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1145733178 17:27209058-27209080 CCTGTCATGGGGTCGGGGGCTGG + Intergenic
1145761395 17:27427170-27427192 CCTGTCATGGGGTTGGGGGAAGG - Intergenic
1146103568 17:30009959-30009981 CCTGTCATGGGGTCGGGGGATGG - Intronic
1146161447 17:30561328-30561350 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1146310481 17:31764656-31764678 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1146425998 17:32739486-32739508 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1147049855 17:37785699-37785721 CCTGTCATGGGGTTGGGGGATGG - Intergenic
1148190276 17:45673761-45673783 CCTGTCATGGGGTCGGGGGAGGG - Intergenic
1149168688 17:53783688-53783710 CCTGTCATGGAGTCAGGGGAGGG + Intergenic
1149359102 17:55874482-55874504 CCTGTCATGGAGTGGGGGGAAGG - Intergenic
1149936773 17:60815287-60815309 CCTGTCATGGGGTTGGGGGAGGG + Intronic
1150857864 17:68770474-68770496 CCTGTCATGGAGTGGGGGGAGGG - Intergenic
1150932874 17:69604063-69604085 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1151502659 17:74501548-74501570 CCTGTCAAGGGGTGGGGGGCTGG - Intergenic
1151567986 17:74910531-74910553 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1152250168 17:79208368-79208390 CCCTCCAAGCAGTCCGGGGAAGG + Intronic
1153059154 18:978104-978126 CCTGTCATGGGGTCGGGGGAGGG + Intergenic
1153356002 18:4136015-4136037 CCTGTCATGAGGTGGGGGGAGGG - Intronic
1153438023 18:5087631-5087653 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1153965999 18:10182441-10182463 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1155681435 18:28491489-28491511 CCTGTTGTGGAGTCGGGGGAGGG + Intergenic
1156011440 18:32501683-32501705 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1156093818 18:33505101-33505123 CAGGTCAAGCAGTGGGGGGCGGG - Intergenic
1156728266 18:40157415-40157437 CCTGTCATGGGGTAGGGGGAAGG - Intergenic
1157787525 18:50498660-50498682 CCTGTCGTGGGGTCGGGGGAGGG - Intergenic
1158061844 18:53353910-53353932 CCTGTCGTGAGGTCGGGGGAGGG - Intronic
1158086434 18:53656885-53656907 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1158100857 18:53828530-53828552 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
1158911146 18:62063921-62063943 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1158942626 18:62419602-62419624 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1159008341 18:63034265-63034287 CCTGTCATGGGGTCGGGGGAGGG - Intergenic
1159219159 18:65437510-65437532 CCTGTTGAGGGGTCGGGGGACGG + Intergenic
1159383345 18:67690905-67690927 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1159610150 18:70515797-70515819 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1160969813 19:1762587-1762609 CCTGTCAGGCTGTTGGGGGCCGG - Intronic
1160999754 19:1904655-1904677 ACTGTCAAGCTGTTGGGGGAGGG + Intergenic
1162629054 19:11911665-11911687 CCTGTCATGGGGTAGGGGGAGGG + Intronic
1162632302 19:11938382-11938404 CCTGTCATGGGGTAGGGGGAAGG - Intronic
1162884928 19:13689898-13689920 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
1163262511 19:16199694-16199716 CCTTCCAAGAAGGCGGGGGAGGG - Intronic
1163869269 19:19804926-19804948 CCTGTCATGGGGTGGGGGGATGG + Intronic
1164423244 19:28116358-28116380 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1164466984 19:28495508-28495530 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
1164622977 19:29708322-29708344 GCTGTCAAGCACTCTGGGAAGGG - Exonic
1164688109 19:30184805-30184827 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1165603212 19:37076521-37076543 CCTGTCAGGGAGTGGGGGTAGGG - Intronic
1165647771 19:37457680-37457702 CCTGTCATGGGGTTGGGGGAGGG + Intronic
1165847052 19:38824898-38824920 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
1166097080 19:40547177-40547199 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1166138477 19:40791927-40791949 CCTGTCAAGAAGTTTGGGGCCGG - Intronic
1166653255 19:44591347-44591369 CCTGTCAGGAGGTGGGGGGATGG + Intergenic
1167519561 19:49945847-49945869 CCTGTCAAGGGGCCGGGGGAGGG - Intronic
1202696223 1_KI270712v1_random:128669-128691 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
925097122 2:1215702-1215724 CCTGTCATGGGGTTGGGGGAGGG - Intronic
925301324 2:2815023-2815045 CCTGTCATGGGGTAGGGGGAAGG - Intergenic
925756537 2:7138287-7138309 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
925900385 2:8505189-8505211 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
926638021 2:15204852-15204874 CCTGTCATGCAGTTGGGGGAAGG + Intronic
927014662 2:18946286-18946308 CCTGTCATGGGGTCGGGGGAGGG - Intergenic
928213423 2:29340952-29340974 CCTGACTAGCACTCAGGGGATGG + Intronic
928617658 2:33055806-33055828 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
928718015 2:34085564-34085586 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
928720346 2:34114001-34114023 CCTGTCATGGTGTGGGGGGAGGG - Intergenic
928754519 2:34508256-34508278 CCTGTCATGAGGTTGGGGGATGG + Intergenic
928755605 2:34521881-34521903 CCTGTCATGGGGTCGGGGGCTGG + Intergenic
929111768 2:38410925-38410947 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
929256413 2:39815731-39815753 CCTGTTGAGGAGTCGGGTGAGGG + Intergenic
929737270 2:44563621-44563643 CCTGTCATGGGGTGGGGGGAAGG - Intronic
930038489 2:47102755-47102777 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
930295340 2:49546940-49546962 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
930451157 2:51539955-51539977 CCTGTCATGGGGTTGGGGGATGG - Intergenic
930502221 2:52235694-52235716 CCTGTCATGGGGTAGGGGGATGG + Intergenic
930505291 2:52275526-52275548 CCTGTCATGGAGTTGGGGGAGGG + Intergenic
931204094 2:60130324-60130346 CCTGTCATGGGGTGGGGGGATGG - Intergenic
931332971 2:61307308-61307330 CCTGTCATGGGGTGGGGGGAGGG + Intronic
931723746 2:65088503-65088525 CCAGTCAAGCAGTCAGGTGGAGG - Exonic
932310696 2:70737568-70737590 CCTGTCATGGGGTGGGGGGAGGG + Intronic
932672001 2:73745979-73746001 CCTGTCATGAGGTGGGGGGATGG + Intergenic
933017115 2:77141464-77141486 CCTGTCATGGGGTGGGGGGAGGG + Intronic
933070100 2:77846223-77846245 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
933342119 2:81037432-81037454 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
933386636 2:81619175-81619197 CCTGTCGTGGAGTAGGGGGAGGG + Intergenic
933653519 2:84868429-84868451 CCTGTCATGGGGTAGGGGGAGGG + Intronic
933835223 2:86240478-86240500 CCTCTGAAGCGGGCGGGGGAAGG + Intronic
934277389 2:91585700-91585722 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
934314791 2:91907322-91907344 CCTGTCATGGAGTGGGGGGAGGG + Intergenic
934495817 2:94796915-94796937 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
934505047 2:94883585-94883607 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
936866445 2:117080151-117080173 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
936926677 2:117744138-117744160 CCTGTCATGGGGTCGGGGGAGGG - Intergenic
937069317 2:119050627-119050649 CCTGACCAGAACTCGGGGGAGGG - Intergenic
937544243 2:122996910-122996932 CCTGTCATGCGGTGGGGGAAGGG - Intergenic
937811703 2:126206727-126206749 CCTGTCATGGGGTCGGGGAAGGG - Intergenic
938026826 2:127956547-127956569 CCTGTCATGGGGTGGGGGGAGGG + Intronic
938272756 2:129989649-129989671 CCTGTCATGGGGTGGGGGGATGG + Intergenic
938443479 2:131356469-131356491 CCTGTCATGGGGTGGGGGGATGG - Intergenic
938590600 2:132732285-132732307 CCTGTCAAGGGGTGGGGGGAGGG + Intronic
938684859 2:133728347-133728369 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
939077874 2:137625318-137625340 CCTGTCATGGGGTGGGGGGAGGG + Intronic
939328406 2:140725528-140725550 CCTGTCATGGGGTGGGGGGAGGG + Intronic
939491488 2:142882477-142882499 CCTGTCGTGGAGTGGGGGGATGG - Intronic
939526806 2:143305316-143305338 CCTGTCAGGGGGTCGGGGGCTGG + Intronic
940017526 2:149122567-149122589 CCTGTCATGGGGTGGGGGGAGGG - Intronic
940643898 2:156370411-156370433 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
940703325 2:157073595-157073617 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
940731410 2:157397296-157397318 CCTGTCATGTGGTGGGGGGAGGG - Intergenic
941056562 2:160796156-160796178 CCTGTCATGGGGTTGGGGGATGG + Intergenic
941532940 2:166691774-166691796 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
941537584 2:166741987-166742009 CCGTTCAAGCTGTAGGGGGAGGG - Intergenic
941550298 2:166907762-166907784 CCTGTCATGGGGTGGGGGGAGGG - Intronic
941648789 2:168070593-168070615 CCTGTCATGGAGTTGGGGGAGGG - Intronic
941830863 2:169957555-169957577 CCTGTCGTGGGGTCGGGGGAGGG + Intronic
943103109 2:183510768-183510790 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
943159415 2:184228347-184228369 CCTGTCATGGAGTGGGGGGAGGG - Intergenic
943316525 2:186395900-186395922 TCTGTCATGGGGTCGGGGGAGGG - Intergenic
943571663 2:189581392-189581414 CCTGCTATGCAGTCCGGGGAAGG - Intronic
943621210 2:190150209-190150231 CCTGGCCAGAACTCGGGGGAGGG - Intronic
943929425 2:193831017-193831039 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
943945225 2:194052306-194052328 CCTGTCATGGAGTGGGGGGCAGG + Intergenic
944001969 2:194850707-194850729 TCTGTCATGGAGTGGGGGGAGGG - Intergenic
944195422 2:197048337-197048359 CCTGTCAGGGAGTGGGGGGCAGG - Intronic
944495245 2:200300901-200300923 AATGTCAAGCAGTTGAGGGATGG - Intergenic
944569541 2:201029772-201029794 CCTGTCATGAGGTGGGGGGATGG + Intronic
944728962 2:202499089-202499111 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
945350013 2:208766125-208766147 CCTGTCATGGGGTGGGGGGAGGG + Intronic
945917749 2:215721881-215721903 CCTGTCAGGGAGTCGGGGGAGGG + Intergenic
946205345 2:218102753-218102775 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
946207394 2:218119760-218119782 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
946586226 2:221190797-221190819 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
946635324 2:221718801-221718823 CCTATCATGGAGTGGGGGGATGG - Intergenic
946895265 2:224317896-224317918 CCTGTCATGAGGTCGGGGGAGGG + Intergenic
946925506 2:224622829-224622851 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
947279963 2:228440672-228440694 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
947634263 2:231672290-231672312 CCTGTTATGAAGGCGGGGGAGGG - Intergenic
1168885475 20:1250003-1250025 CCTGTCATGGGGTCGGGGGAGGG - Intronic
1168903589 20:1386629-1386651 CCTGTCATGCAGTGGGGAGTGGG + Intronic
1169145310 20:3248548-3248570 CCTGTCAACCAGTCGCTGGGTGG - Intergenic
1169261086 20:4138593-4138615 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1169642470 20:7769584-7769606 CCAGTGAAGCAGTAGGGGGTTGG - Intergenic
1169826410 20:9773386-9773408 CCTGTCGTGGGGTCGGGGGAAGG - Intronic
1170054907 20:12191471-12191493 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1170186753 20:13599520-13599542 CCTGTCAGGCGGTGGGGGGCTGG + Intronic
1170324588 20:15142659-15142681 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1170375883 20:15699747-15699769 CCTGGCAAGAACTCAGGGGAGGG - Intronic
1170832289 20:19853030-19853052 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1171088002 20:22256121-22256143 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1171090240 20:22278304-22278326 CCTGTCATGGGGTTGGGGGACGG + Intergenic
1171261473 20:23738102-23738124 CCCTTCAAGCTGTAGGGGGAAGG + Intergenic
1171270613 20:23813993-23814015 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1171431829 20:25087769-25087791 GCTGTCCATCAGTCTGGGGAGGG + Intergenic
1171934680 20:31263191-31263213 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1172340613 20:34154606-34154628 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1174083377 20:47986938-47986960 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1174781971 20:53397973-53397995 CCTGTCATGGAGTGGGGGGAGGG + Intronic
1175702134 20:61147335-61147357 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
1175751041 20:61498050-61498072 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1176130573 20:63495126-63495148 CCTGCCAGGCAGGCGGGGCAGGG - Intronic
1176203587 20:63875922-63875944 CCTGACACTCAGTCGGGGAAGGG + Intronic
1176670191 21:9726734-9726756 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1176736730 21:10556190-10556212 CCTGTCATGGGGTGGGGGGATGG - Intronic
1177849349 21:26328161-26328183 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1177859871 21:26439960-26439982 CCTGTCATGAGGTGGGGGGAGGG - Intergenic
1178232688 21:30804851-30804873 CCTGTCAGGGAGTGGGGGGCAGG + Intergenic
1178748003 21:35272086-35272108 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1179372634 21:40820453-40820475 CCTGTCAGGGAGTGGGGGCAAGG + Intronic
1179428396 21:41301030-41301052 CCTGTCATGCGGTGGGGGGAGGG + Intergenic
1179942485 21:44649104-44649126 TCTGTCCAGCAGGCGGTGGAGGG - Intronic
1180541548 22:16453197-16453219 CCTGTCATGGAGTGGGGTGAGGG + Intergenic
1180562718 22:16633650-16633672 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1181449215 22:23006665-23006687 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1181610208 22:24006933-24006955 CCTGTCATGCAGGCTGGGGCAGG - Intergenic
1182986740 22:34725440-34725462 CCTGTCAGGGGGTCGGGGAAGGG + Intergenic
1183532405 22:38366486-38366508 CCTGTCATGGGGTGGGGGGATGG + Intronic
1183964199 22:41431644-41431666 CCTGTCATGCTGTCAGCGGAGGG - Intergenic
1184250736 22:43258719-43258741 CTTGTCAAGCTGTCGGGGGAGGG + Intronic
949421290 3:3868714-3868736 CCTGTCATGGGGTGGGGGGAGGG + Intronic
949427668 3:3936863-3936885 CCTGTCATGGGGTGGGGGGAGGG - Intronic
950383896 3:12641206-12641228 CCTGTCATGGGGTGGGGGGAGGG + Intronic
950592448 3:13948129-13948151 CCTGGCAAGAACTCGGGGGAGGG - Intronic
951239436 3:20271858-20271880 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
951942679 3:28097862-28097884 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
952016498 3:28962708-28962730 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
952118428 3:30212915-30212937 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
953204028 3:40805017-40805039 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
953271919 3:41454020-41454042 CCTGTCATGGGGTGGGGGGAGGG + Intronic
953564823 3:44022268-44022290 CCCGCAAAGAAGTCGGGGGAGGG - Intergenic
953595460 3:44308275-44308297 CCTGTCATGGGGTTGGGGGAGGG - Intronic
953622982 3:44548734-44548756 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
953652133 3:44816390-44816412 CCTGTCAAGGGGTGGGGGGCTGG - Intronic
954061835 3:48074301-48074323 CCTGTCATGGGGTGGGGGGAGGG + Intronic
954232308 3:49226898-49226920 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
954492292 3:50917907-50917929 CCTGTCATGGGGTTGGGGGAGGG - Intronic
954503676 3:51047250-51047272 CCTGTCATGAGGTTGGGGGAGGG + Intronic
954511980 3:51133311-51133333 CCTGTCATGGGGTGGGGGGAGGG - Intronic
954586944 3:51744506-51744528 CCTTTCAAGCTGTAGGGGGAGGG + Intergenic
955157313 3:56429383-56429405 CCTGTAGAACAGTTGGGGGAGGG - Intronic
955982951 3:64545601-64545623 CCTGTCATGGAGTTGGGGGCAGG + Intronic
956027732 3:65001472-65001494 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
956545332 3:70395077-70395099 GCTGCTAAGCAGTTGGGGGATGG - Intergenic
956781833 3:72609518-72609540 CCTGTCGTGGGGTCGGGGGAAGG + Intergenic
956842999 3:73157325-73157347 CCTTTCAAGCTGTAGGGGGAGGG - Intergenic
957265951 3:77966105-77966127 CCTGTCCTGGAGTAGGGGGAAGG + Intergenic
957562052 3:81834603-81834625 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
957644334 3:82901578-82901600 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
957644890 3:82907997-82908019 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
957696104 3:83639548-83639570 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
957713392 3:83893319-83893341 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
958043926 3:88260062-88260084 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
958073606 3:88647602-88647624 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
958549249 3:95593304-95593326 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
958554080 3:95651062-95651084 CCTGTCGTGGAGTTGGGGGATGG + Intergenic
958708538 3:97688568-97688590 CCTGTCATGGGGTGGGGGGAGGG + Intronic
958770217 3:98417159-98417181 TCTGTCATGGAGTAGGGGGATGG - Intergenic
958811545 3:98865857-98865879 CCTGTCATGGGGTGGGGGGAGGG - Intronic
959213466 3:103418960-103418982 CCTGTCATGGGGTCGGGGGAGGG + Intergenic
959726187 3:109544155-109544177 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
960016056 3:112889449-112889471 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
960063648 3:113348703-113348725 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
960212555 3:114988248-114988270 CCTGTCATGGGGTTGGGGGAGGG - Intronic
960332755 3:116382497-116382519 CCTGTCATGGGGTCGGGGGAGGG + Intronic
960643838 3:119855822-119855844 CCTGTCGTGCGGTGGGGGGAGGG + Intronic
960772323 3:121208326-121208348 CCTGTCATGGGGTGGGGGGAGGG + Intronic
960943511 3:122950279-122950301 CCGGTGAAGCAGTGGGGAGAGGG + Intronic
961984282 3:131116123-131116145 CCTGTCATGGGGTGGGGGGAAGG - Intronic
962355652 3:134692257-134692279 CCTGTCATGGGGTTGGGGGAGGG - Intronic
963021214 3:140874525-140874547 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
963421537 3:145066472-145066494 CCTGTCGTGGAGTGGGGGGAGGG + Intergenic
963527673 3:146434919-146434941 CCTGTCATGGGGTGGGGGGAGGG - Intronic
963696710 3:148573014-148573036 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
963875867 3:150473527-150473549 CCTGTCGTGGGGTCGGGGGAGGG + Intergenic
963997632 3:151728893-151728915 CCTGTCATGGAGTGGGGGGAGGG - Intergenic
964083674 3:152790209-152790231 CCTGTCATGGGGTCGGGGGAGGG - Intergenic
964160589 3:153640739-153640761 CCTGGCCAGAACTCGGGGGAGGG + Intergenic
964170669 3:153766558-153766580 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
964264697 3:154880979-154881001 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
965052754 3:163671601-163671623 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
965062709 3:163803765-163803787 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
965147258 3:164922628-164922650 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
965204642 3:165705616-165705638 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
965518338 3:169646301-169646323 CCTGTCATGGGGTGGGGGGAGGG + Intronic
965650965 3:170933065-170933087 CCTGTCGTGGGGTCGGGGGAAGG - Intergenic
965707058 3:171519788-171519810 CCTGTCAGGCTGTGGGGGTAAGG + Intergenic
966191268 3:177273790-177273812 CCTGTCATGGAGTGGGGGAAGGG - Intergenic
966437856 3:179908616-179908638 CTTGTCATGGAGTAGGGGGAGGG - Intronic
966480976 3:180408054-180408076 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
966569930 3:181430118-181430140 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
966573409 3:181473104-181473126 CCTGTCAGGGAGTGGGGGTAAGG - Intergenic
966661561 3:182420206-182420228 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
966992070 3:185242856-185242878 CCTGGCCAGAACTCGGGGGAGGG - Intronic
967065287 3:185909921-185909943 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
967333175 3:188312977-188312999 CCTGTCATGGGGTTGGGGGACGG + Intronic
967569352 3:191010689-191010711 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
967583576 3:191187619-191187641 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
969312079 4:6359338-6359360 CCTGTCATGGAGTGGGGGAATGG + Intronic
969467591 4:7366768-7366790 CCTGTGAAGCTGTTGGGGGTTGG - Intronic
969494695 4:7519901-7519923 CCTGTTAAGCAGGCGGGGCAGGG + Intronic
969781585 4:9408682-9408704 CCTGGCCAGAACTCGGGGGAGGG + Intergenic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
970304238 4:14715039-14715061 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
970415981 4:15857380-15857402 CCTGTCGTGGGGTCGGGGGAGGG - Intergenic
970687091 4:18580886-18580908 CCTGTCAAGGGGTGGGGGCAAGG - Intergenic
970830723 4:20336524-20336546 CCTCTCATGGAGTTGGGGGAGGG + Intronic
970884237 4:20968770-20968792 CCTGTCAAGGGGTGGGGGGCTGG + Intronic
970895560 4:21099455-21099477 CTTGTCAAGGAGGTGGGGGAAGG + Intronic
970954462 4:21794116-21794138 CCTGTCACGGGGTAGGGGGAGGG + Intronic
971281250 4:25244194-25244216 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
971578427 4:28305197-28305219 CCCTTCAAGCTGTAGGGGGAAGG + Intergenic
971867539 4:32191391-32191413 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
972117807 4:35659463-35659485 CCTGCCAGGTGGTCGGGGGAGGG - Intergenic
972868176 4:43260364-43260386 CCTTTCAGGGAGTTGGGGGAAGG - Intergenic
972905847 4:43745964-43745986 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
973097576 4:46222361-46222383 CCTGTCAGGGAGTGGGGGGTTGG - Intergenic
973315831 4:48759074-48759096 CCTGTCATGGCGTTGGGGGAAGG + Intronic
973561272 4:52138661-52138683 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
973787029 4:54341845-54341867 CCTGGCCAGAACTCGGGGGAGGG + Intergenic
973874007 4:55195958-55195980 CCTGTCAGGGGGTGGGGGGAAGG + Intergenic
974077403 4:57179971-57179993 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
974114082 4:57559430-57559452 CCTGTCAGGGGGTCGGGGGCTGG - Intergenic
974284622 4:59847800-59847822 CCTGTCATGGAGTGGGGGGAGGG + Intergenic
974361533 4:60887237-60887259 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
974470748 4:62315219-62315241 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
974526511 4:63055032-63055054 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
974671011 4:65030079-65030101 CCTGTCGTGGGGTCGGGGGAGGG + Intergenic
974774055 4:66457482-66457504 CCTGTCATGTGGTGGGGGGATGG - Intergenic
974964691 4:68746625-68746647 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
975515763 4:75246050-75246072 CCTGTCATGCGGTGAGGGGAGGG + Intergenic
975595891 4:76047997-76048019 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
975641630 4:76506221-76506243 CCTGTCAGGTAGTGGGGGGCTGG + Intronic
976062439 4:81144755-81144777 CCTGTCATGGGGTGGGGGGAGGG - Intronic
976505998 4:85848331-85848353 CCTGTCATGGGGTAGGGGGATGG - Intronic
976938345 4:90667490-90667512 CCTGTCAGGGAGTGGGGGGCTGG - Intronic
977298337 4:95236426-95236448 CCTGTTGAGCAGTTGGGGGAGGG + Intronic
977456726 4:97271092-97271114 CCTGTCATGGGGTGGGGGGAGGG - Intronic
977680425 4:99792799-99792821 CCTGTCATGGGGTGGGGGGACGG - Intergenic
977834966 4:101636088-101636110 CTTTTCAAGCTGTAGGGGGAGGG - Intronic
977884049 4:102237485-102237507 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
977900338 4:102415116-102415138 CCTGTCATGGGGTGGGGGGAGGG + Intronic
977947022 4:102925397-102925419 CCTGTCATGGAGTGTGGGGAGGG + Intronic
978013299 4:103713465-103713487 CCTGTCATGGGGTGGGGGGAGGG + Intronic
978636240 4:110810568-110810590 CCTGTCATGGAGTCGGGGGAGGG + Intergenic
979018465 4:115464966-115464988 CCTGTCATGGGGTGGGGGGATGG - Intergenic
979031940 4:115659791-115659813 CCTGTCAAGCCTTCAGGGTAAGG + Intergenic
979208744 4:118075049-118075071 CCTGTCATGGGGTGGGGGGATGG - Intronic
979758144 4:124367225-124367247 CCTGTCATGGGGTCGGGGGATGG + Intergenic
979840666 4:125436033-125436055 CCTGTCATGGGGTCGGGGGAGGG + Intronic
980290942 4:130847028-130847050 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
980334769 4:131457203-131457225 CCTGTCATGGAGTCGGGGGCAGG + Intergenic
980336518 4:131481115-131481137 CCTGTCGTGGGGTCGGGGGAGGG + Intergenic
980399389 4:132259983-132260005 CCTGTCATGGGGTAGGGGGAGGG + Intergenic
980559489 4:134454272-134454294 CCTGTCATGGGGTGGGGGGATGG + Intergenic
980591871 4:134901218-134901240 CCTGTCGTGCAGTGGGGGGAGGG - Intergenic
980597496 4:134973001-134973023 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
980675349 4:136071518-136071540 CCTGTCATGGAGTGGGGGGAGGG + Intergenic
980813393 4:137913153-137913175 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
981155835 4:141433819-141433841 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
981172544 4:141641684-141641706 CCTGTCATGGGGTGGGGGGAGGG + Intronic
982218834 4:153107424-153107446 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
982383192 4:154771919-154771941 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
982384634 4:154787331-154787353 CCTGTCATGGGGTGGGGGGAGGG - Intronic
982701077 4:158660167-158660189 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
982854910 4:160369510-160369532 CCTGTCATGGAGTGGGGGGAGGG + Intergenic
983108408 4:163719178-163719200 CCTGTCATGGGGTTGGGGGAGGG - Intronic
983135416 4:164073489-164073511 CCTGTCAGGGAGTGGGGGGCAGG + Intronic
983457364 4:167982170-167982192 CCTGTCAGGGGGTGGGGGGAGGG - Intergenic
984179873 4:176469129-176469151 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
984308356 4:178023856-178023878 CCTGTCACGGGGTGGGGGGAGGG + Intergenic
984518792 4:180775387-180775409 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
984541260 4:181040199-181040221 ACTGTCATGGAGTGGGGGGAGGG - Intergenic
984721620 4:182978085-182978107 CCTGGCCAGAACTCGGGGGAGGG + Intergenic
984917399 4:184736621-184736643 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
986687390 5:10286690-10286712 GCTGTCAGGCAGTTGGAGGAGGG - Intronic
986895490 5:12361816-12361838 TCTGTCAAGCAGTCAGCGTAAGG + Intergenic
986933262 5:12853654-12853676 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
987156942 5:15098075-15098097 CCTGTCATGGAGTGGGGGGAGGG - Intergenic
987351461 5:17025884-17025906 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
987545296 5:19305135-19305157 CCTTTCAAGCTGTAGGAGGAGGG - Intergenic
987578912 5:19763091-19763113 CCTGTCATGGGGTCTGGGGATGG + Intronic
987929847 5:24389367-24389389 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
988090436 5:26532690-26532712 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
988187300 5:27884037-27884059 CCTGTCATGGGGTGGGGGGATGG - Intergenic
988491242 5:31707146-31707168 CCTGTCATGGGGTGGGGGGAGGG + Intronic
988592065 5:32557676-32557698 CCTTGCAAGCTGTAGGGGGAGGG - Intronic
988645006 5:33085128-33085150 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
988840705 5:35081034-35081056 CCTGTCATGGGGTGGGGGGAGGG + Intronic
989290098 5:39754174-39754196 CCTGTCATGCGGTGGGGGGCTGG + Intergenic
989310675 5:40013325-40013347 CCTGTCGTGGGGTCGGGGGAAGG + Intergenic
989551805 5:42744260-42744282 CCTGTCGTGGGGTCGGGGGAGGG + Intergenic
989584023 5:43060417-43060439 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
989813274 5:45704320-45704342 CCTGTCAGGGGGTGGGGGGAAGG - Intergenic
989823040 5:45818599-45818621 CCTGTCATGGGGTAGGGGGAAGG + Intergenic
989957300 5:50372526-50372548 CCCTTCGAGCAGTAGGGGGAGGG + Intergenic
990091674 5:52059110-52059132 CCTGTCATGGGGTGGGGGGAGGG - Intronic
990228516 5:53685215-53685237 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
990367919 5:55088990-55089012 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
990456193 5:55990887-55990909 CCTGTCATGGGGTAGGGGGAGGG - Intronic
990489704 5:56292869-56292891 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
990808269 5:59691563-59691585 TCTGTCATGGAGTGGGGGGAGGG + Intronic
990827712 5:59920853-59920875 CCTGTCATGTGGTGGGGGGAGGG + Intronic
990921340 5:60971610-60971632 CCTGTCATGGGGTTGGGGGAGGG - Intronic
990993785 5:61711232-61711254 CCTGTCATGCGGTGGGGGGATGG - Intronic
991140042 5:63230095-63230117 CCTGTCATGGGGTCGGGGGATGG - Intergenic
991535071 5:67661021-67661043 CCTGTCATGGGGTTGGGGGATGG - Intergenic
991553196 5:67866143-67866165 CCTGTCATGGGGTGGGGGGATGG - Intergenic
991584419 5:68187654-68187676 CCTGTCACGGAGACGGGAGATGG + Intergenic
992028854 5:72700531-72700553 CCTGTCATGTGGTGGGGGGATGG - Intergenic
992049311 5:72928499-72928521 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
992183527 5:74221846-74221868 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
992340144 5:75814857-75814879 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
992342657 5:75841366-75841388 CCTGTTATGGGGTCGGGGGAGGG - Intergenic
992455149 5:76909685-76909707 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
992772638 5:80062682-80062704 CCTGTCATGGGGTAGGGGGAGGG - Intronic
992875710 5:81053273-81053295 CCTGTCATGGGGTGGGGGGAGGG - Intronic
992973388 5:82085482-82085504 CCTGTCATGGGATCGGGGGAGGG + Intronic
993075366 5:83223829-83223851 CCTGTCATGGGGTGGGGGGAGGG - Intronic
993202652 5:84836407-84836429 CCTGTCATGAGGTGGGGGGAGGG + Intergenic
993296349 5:86146392-86146414 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
993474533 5:88348351-88348373 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
993489732 5:88532304-88532326 CCTGTCAAGGGGTAGGGGGCTGG + Intergenic
993871593 5:93260838-93260860 CCTGTCATGGGGTTGGGGGATGG + Intergenic
993916992 5:93755877-93755899 CCTGGCCAGAACTCGGGGGAGGG + Intronic
993999906 5:94766515-94766537 CCTGTCATGGGGTTGGGGGAGGG + Intronic
994033554 5:95172533-95172555 CCTGTGAAGAAGTCCTGGGAGGG - Intronic
994051364 5:95365971-95365993 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
994198201 5:96942717-96942739 CCTGTCATGGAGTCGGGGGAGGG + Intronic
994231786 5:97316079-97316101 CCCATCAAGCTGTAGGGGGAGGG - Intergenic
994294912 5:98079525-98079547 CCTGTCGTGGGGTCGGGGGAAGG + Intergenic
994343394 5:98658902-98658924 CCTGTCGTGGGGTCGGGGGAAGG - Intergenic
995074615 5:107967524-107967546 CCTGTCATGAGGTGGGGGGAGGG + Intronic
995117374 5:108496400-108496422 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
996099282 5:119430655-119430677 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
996108745 5:119539425-119539447 CCTGTCATGGGGTTGGGGGAGGG + Intronic
996128471 5:119753032-119753054 CCTGGCCAGAATTCGGGGGAGGG + Intergenic
996678392 5:126202579-126202601 CCTGGCCAGAACTCGGGGGAGGG + Intergenic
996680331 5:126223488-126223510 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
996896257 5:128486770-128486792 CCTGTCATGAGGTGGGGGGATGG - Intronic
997072351 5:130635785-130635807 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
997602834 5:135152039-135152061 CCTGTCATGGGGTGGGGGGAGGG + Intronic
998154423 5:139776313-139776335 CCAGTCATGCACTTGGGGGAGGG - Intergenic
998748536 5:145290593-145290615 CCTGTCATGCGGTTGGGGGAGGG + Intergenic
998781023 5:145656745-145656767 CCTGTCATGGGGTGGGGGGAGGG + Intronic
999397816 5:151241463-151241485 CTTGTCAAGCAGGCTGGGCAGGG - Intronic
999482693 5:151963362-151963384 CCTGTGAAGAAGTCAGGGCAGGG + Intergenic
999484933 5:151985687-151985709 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1000085172 5:157882208-157882230 CCCTTCAAGCTGTCGGGGGAGGG + Intergenic
1000748733 5:165068479-165068501 CCTGTCAGGAGGTTGGGGGAAGG - Intergenic
1001071846 5:168592695-168592717 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1001180677 5:169517165-169517187 CCTGTCAGGGGGTGGGGGGATGG - Intergenic
1002127411 5:177056758-177056780 CCTGTCATGGGGTTGGGGGAGGG + Intronic
1002336406 5:178481865-178481887 CCTGTCATGGGGTCGGGGGAGGG + Intronic
1002661325 5:180792716-180792738 CCTGTCGAGCCAGCGGGGGAGGG - Exonic
1003228546 6:4228549-4228571 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1003470843 6:6430060-6430082 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1003690451 6:8348304-8348326 CCTGTCATGGAGTTGGGGGTAGG + Intergenic
1003793373 6:9572768-9572790 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1004032433 6:11883855-11883877 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1004549991 6:16637339-16637361 CCTGTCATGGAGTGGGGGGAGGG + Intronic
1004840336 6:19576746-19576768 CCTGTTGTGCAGTGGGGGGAGGG + Intergenic
1005121088 6:22389980-22390002 CCTGCCAAGCTCCCGGGGGAGGG - Intergenic
1006109245 6:31734865-31734887 CCTGTCAAGGATGTGGGGGAAGG + Intronic
1006237775 6:32650693-32650715 CCTGTCGGGGAGTCGGGGGTTGG + Intergenic
1007029975 6:38618602-38618624 CCCTTCAAGCTGTAGGGGGAGGG + Intronic
1007199114 6:40090572-40090594 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1007360940 6:41355101-41355123 CCTGTCATGGGGTCAGGGGACGG + Intergenic
1007386894 6:41526431-41526453 CCTGGCCAGCAGGCTGGGGATGG - Intergenic
1007394512 6:41569923-41569945 AATGTCAGGCAGTTGGGGGAGGG + Intronic
1007982239 6:46171082-46171104 CCTGTCAATCAGCGGGGGCAGGG + Intergenic
1008122689 6:47635788-47635810 CCTGTCATAGGGTCGGGGGAGGG - Intergenic
1008213758 6:48759397-48759419 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1008269782 6:49477413-49477435 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1008363050 6:50644171-50644193 ACTGTGGTGCAGTCGGGGGAGGG - Intergenic
1008398821 6:51039940-51039962 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1008535340 6:52503056-52503078 CCTGTCTTGCAATGGGGGGAGGG - Exonic
1008587051 6:52959857-52959879 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1008724645 6:54402031-54402053 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1009385994 6:63084608-63084630 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1009836175 6:69004561-69004583 CCTGTCATGGGGTCGGGGGAGGG - Intronic
1009872725 6:69470328-69470350 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1009910762 6:69924250-69924272 CCTGTCATGGGGTGGGGGGAAGG - Intronic
1010074892 6:71787747-71787769 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1010178566 6:73057321-73057343 CCTGTCATGGGGTGGGGGGAAGG + Intronic
1010269777 6:73906068-73906090 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1010289541 6:74119582-74119604 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1010505559 6:76654157-76654179 CCTGTCGTGGGGTCGGGGGATGG - Intergenic
1010512511 6:76737911-76737933 CCTGTCCTGGGGTCGGGGGATGG + Intergenic
1010669113 6:78665794-78665816 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1011240458 6:85266776-85266798 CCTGTCATGAGGTTGGGGGAGGG - Intergenic
1011282925 6:85694945-85694967 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1011375105 6:86679197-86679219 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1011405776 6:87014103-87014125 CCTGTCGTGGGGTCGGGGGACGG + Intronic
1011433050 6:87308219-87308241 CCTGACATGGGGTCGGGGGAGGG + Intronic
1011893371 6:92194401-92194423 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1012188633 6:96253317-96253339 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1012372360 6:98523164-98523186 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1012441608 6:99266621-99266643 CCCTTCAAGCTGTGGGGGGAGGG - Intergenic
1012609187 6:101194439-101194461 CCTGTCATGTGGTCGGGGAAGGG + Intergenic
1012687823 6:102274709-102274731 CCTGTCGTGGAGTGGGGGGAGGG - Intergenic
1012799604 6:103807832-103807854 CCTGTCAGGAGGTGGGGGGAGGG + Intergenic
1013592942 6:111635021-111635043 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1013610008 6:111785816-111785838 CCTGTCGTGGGGTCGGGGGAGGG - Intronic
1013726721 6:113106864-113106886 CCTGTCGTGGGGTCGGGGGATGG + Intergenic
1013877814 6:114855618-114855640 CCTGGCCAGAACTCGGGGGAGGG + Intergenic
1013977365 6:116093283-116093305 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1014359243 6:120455277-120455299 CCTGTCGTGGAGTTGGGGGAGGG + Intergenic
1014478745 6:121908822-121908844 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1014648402 6:124004704-124004726 CCTGTCAGGTGGTGGGGGGATGG + Intronic
1014649804 6:124022042-124022064 CCTGTCATGGGGTAGGGGGAGGG - Intronic
1014815930 6:125935487-125935509 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
1015194345 6:130508918-130508940 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1015861253 6:137682664-137682686 CCTGTCATGGGGTCGGGGGAGGG - Intergenic
1015979905 6:138828073-138828095 CCTGTCATGCGGTGGGGGGAGGG - Intronic
1016183972 6:141178352-141178374 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1016486299 6:144543295-144543317 CCTGGGAAGCAGGTGGGGGATGG + Intronic
1016577969 6:145592158-145592180 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1017601007 6:156081194-156081216 CCTGTTATGGGGTCGGGGGAGGG + Intergenic
1018009349 6:159655463-159655485 CCTGCCCAGAACTCGGGGGAGGG + Intergenic
1018295771 6:162341750-162341772 CCTGTCAGGGGGTGGGGGGATGG + Intronic
1018490906 6:164292346-164292368 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1018513756 6:164555387-164555409 CCTGTGAAGCACTAAGGGGATGG - Intergenic
1018531919 6:164774584-164774606 CCTGTCATGGGGTCGGGGGAGGG - Intergenic
1019050816 6:169181978-169182000 CCTGTCGTGGAGTGGGGGGAGGG + Intergenic
1020348858 7:7196211-7196233 CCTGTCATGGGGTTGGGGGAGGG - Intronic
1020562554 7:9747685-9747707 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1020694807 7:11400154-11400176 CCTGTTATGGGGTCGGGGGAGGG + Intronic
1020933244 7:14427088-14427110 CCTGTCAGGGAGTGGGGGGTGGG + Intronic
1020980563 7:15063289-15063311 CCTGTCATGAGGTGGGGGGAGGG - Intergenic
1021272600 7:18609778-18609800 CCTGTCACGGAGTTGGGGGAGGG - Intronic
1021455102 7:20821425-20821447 CCTGTCATGCGGTGGGGGGAGGG - Intergenic
1022361140 7:29659215-29659237 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1022661414 7:32370630-32370652 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
1022934459 7:35157788-35157810 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1023464831 7:40442870-40442892 CCTGTCATGGTGTGGGGGGAAGG - Intronic
1023664239 7:42504855-42504877 CCTGTCATGGGGTAGGGGGAGGG - Intergenic
1023822214 7:43986562-43986584 CCGGTCAAACAGTAGGGGCAGGG - Intergenic
1024738663 7:52332730-52332752 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1025218950 7:57088358-57088380 CCTGTCGTGGGGTCGGGGGAGGG - Intergenic
1025550338 7:62239021-62239043 CCTGTCATGGGGTCGGTGGAGGG - Intergenic
1025582393 7:62736944-62736966 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1025720487 7:64007389-64007411 CCTGTCGTGGAGTTGGGGGATGG - Intergenic
1025789805 7:64679250-64679272 CTCTTCAAGAAGTCGGGGGAAGG - Intronic
1025794822 7:64729687-64729709 CCTGGCAAGAACTCTGGGGAAGG - Intergenic
1027348902 7:77290227-77290249 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1027447764 7:78293928-78293950 CCTGTCATGGTGTTGGGGGAGGG + Intronic
1027571599 7:79875435-79875457 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1027686618 7:81286451-81286473 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1027791055 7:82639269-82639291 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1028316221 7:89406066-89406088 CCTGTCAGGGAGTGGGGGGCAGG - Intergenic
1028495281 7:91454135-91454157 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1028581127 7:92410514-92410536 CCTGTCGTGCAGTGGGGGAATGG + Intergenic
1028693007 7:93675011-93675033 CCTGTCATGGGGTTGGGGGAGGG + Intronic
1028720169 7:94020883-94020905 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1028804520 7:95009144-95009166 CCTGTCATGGGGTCGGGGAAGGG + Intronic
1029750480 7:102539976-102539998 CCGGTCAAACAGTAGGGGCAGGG - Intronic
1029768432 7:102639084-102639106 CCGGTCAAACAGTAGGGGCAGGG - Intronic
1029830395 7:103250571-103250593 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1030132642 7:106215903-106215925 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1030162895 7:106526593-106526615 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
1030220471 7:107093659-107093681 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1030974951 7:116110069-116110091 CCTGTCATGGAGTGGGGGGAAGG + Intronic
1031731720 7:125310012-125310034 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1033056050 7:138055718-138055740 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1033094443 7:138418401-138418423 CCTGTCATGGGGTCGGGGGTGGG - Intergenic
1033176699 7:139130665-139130687 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1033377942 7:140782057-140782079 CCTGTCATGGGGTAGGGGGAGGG - Intronic
1033888085 7:145972539-145972561 CCTGTCATGGGGTCGGGGGATGG + Intergenic
1033922248 7:146408616-146408638 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1034703350 7:153117178-153117200 CCTGTCGTGGAGTCGGGGGAGGG - Intergenic
1036837834 8:12090048-12090070 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1036859624 8:12336296-12336318 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1037576281 8:20206798-20206820 TCTGTCAGGAAGTCAGGGGATGG + Intronic
1037802683 8:22043988-22044010 CCTTTGAAGCAGTGGGGGGGTGG + Intronic
1038430848 8:27498212-27498234 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1039083347 8:33755666-33755688 CCTGGCTAGAACTCGGGGGAAGG - Intergenic
1039275939 8:35934197-35934219 CCTTTCAAGCTGTACGGGGAGGG + Intergenic
1039693238 8:39883305-39883327 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1039789426 8:40862814-40862836 CCTGTCATGCGGTGGGGGGAGGG + Intronic
1039922943 8:41905991-41906013 CCTGTCAGGGAGTCGGGGGGAGG + Intergenic
1039999741 8:42565963-42565985 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1040359128 8:46648263-46648285 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1040412052 8:47164448-47164470 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1040437459 8:47405197-47405219 CCTGTCATGTGGTGGGGGGATGG + Intronic
1040562697 8:48538684-48538706 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1040635735 8:49270784-49270806 CTTGACCAGAAGTCGGGGGAGGG - Intergenic
1040667936 8:49654814-49654836 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1040723498 8:50353248-50353270 CCTGTCATGAGGTGGGGGGAGGG + Intronic
1040953326 8:52956833-52956855 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1040965122 8:53074904-53074926 CCCTTCAAGCTGTAGGGGGAAGG - Intergenic
1041000598 8:53446663-53446685 CCTGTCATGGAGTAGGGGGAGGG + Intergenic
1041570619 8:59333426-59333448 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1041759448 8:61348324-61348346 CCTGTCATGGAGTGGGGGGAGGG + Intronic
1042153043 8:65810340-65810362 CCTGTCATGGGGTGGGGGGATGG + Intronic
1042467196 8:69141149-69141171 CCTGGCCAGAACTCGGGGGAGGG - Intergenic
1042534926 8:69849263-69849285 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1042763615 8:72297113-72297135 CCTGTCATGGGGTCGGGGGTAGG + Intergenic
1042771844 8:72390142-72390164 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1042843423 8:73147417-73147439 CCTGTCAGGCAGGAGGGGGTAGG - Intergenic
1042919548 8:73908204-73908226 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1043318916 8:78957158-78957180 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1043522115 8:81057559-81057581 CCTGTCGTGGGGTCGGGGGAGGG + Intronic
1044005500 8:86932324-86932346 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1044007378 8:86954981-86955003 CCTGTCATGGAGTGGGGGGAGGG - Intronic
1044018717 8:87077565-87077587 CCTGTCATGCGGTAGAGGGATGG - Intronic
1044102460 8:88157819-88157841 CCTGTCATGGGGTGGGGGGATGG - Intronic
1044107162 8:88223684-88223706 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1044221774 8:89678106-89678128 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1044318124 8:90773014-90773036 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1044812356 8:96076394-96076416 CCTGTCATGGGGTAGGGGGAAGG + Intergenic
1044814993 8:96102774-96102796 CCTGTCGTGGAGTGGGGGGACGG - Intergenic
1044939115 8:97322441-97322463 CCTGTCATGAGGTCGGGGGCAGG - Intergenic
1044956063 8:97482257-97482279 CCTGTCATGGGGTTGGGGGATGG - Intergenic
1045606196 8:103779746-103779768 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1045858484 8:106790748-106790770 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1046116556 8:109791443-109791465 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1046252835 8:111655162-111655184 CCTGTCACGGGGTGGGGGGAGGG + Intergenic
1046565475 8:115893839-115893861 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1046736930 8:117786986-117787008 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1046808695 8:118508231-118508253 CCTGTCGTGGGGTCGGGGGAGGG + Intronic
1046848162 8:118942216-118942238 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1046907186 8:119586614-119586636 CAAGTCAAGCAGTTGGGGGTGGG + Intronic
1047437279 8:124845287-124845309 CCTGTCATGGGGTGGGGGGAAGG - Intergenic
1047707160 8:127511248-127511270 CCTGTCATGAGGTGGGGGGAGGG - Intergenic
1048231888 8:132650361-132650383 CCTGTCATGAGGTGGGGGGAGGG + Intronic
1048500996 8:134974881-134974903 CCTGTCTTGCAGACTGGGGAAGG - Intergenic
1048661746 8:136611769-136611791 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1048664916 8:136650143-136650165 CCTGTCATGAGGTAGGGGGATGG + Intergenic
1049971632 9:826707-826729 CCTGTCAATCAGTGGGGAGCGGG + Intergenic
1050282109 9:4061213-4061235 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1050522800 9:6519199-6519221 CCTGTCATGGGGTCGGGGGGAGG - Intergenic
1050854990 9:10343125-10343147 CCTGTCAGGGGGTCGGGGGCTGG - Intronic
1050922060 9:11215883-11215905 CCTGTCATGGGGTCGGGGGAGGG + Intergenic
1050954157 9:11634095-11634117 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1051718558 9:20010757-20010779 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1051935207 9:22436731-22436753 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1051960956 9:22762071-22762093 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1052020553 9:23520677-23520699 CCTGTCAGGGAGTAGGGGGCTGG + Intergenic
1052487009 9:29114550-29114572 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1055087482 9:72328943-72328965 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1055343629 9:75311546-75311568 CCTGTCATGGAGTGGGGGCAGGG - Intergenic
1055458349 9:76493555-76493577 CCCTTCAAGCTGTAGGGGGAGGG - Intronic
1055758893 9:79585441-79585463 TCAGTCAAGCATTTGGGGGAAGG - Intronic
1056096000 9:83254108-83254130 CCTGTCATGGGGTAGGGGGAAGG + Intronic
1056221797 9:84457123-84457145 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1057942352 9:99296381-99296403 CATGTCAAACAGTCGGTGGGCGG - Intergenic
1058253716 9:102735034-102735056 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1059086083 9:111304361-111304383 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1060478494 9:124002037-124002059 GCTGCCAAGCAGGCTGGGGATGG + Intronic
1061717465 9:132529350-132529372 ACTGTCATGGGGTCGGGGGAGGG + Intronic
1062093664 9:134691643-134691665 CCTGTCACCCAGTCGTGGGGCGG + Intronic
1062145424 9:134986836-134986858 CCTGTCATGGAGTGGGGGCAGGG + Intergenic
1062716604 9:138013536-138013558 ACTGTGAATCAGTTGGGGGAGGG + Intronic
1203565817 Un_KI270744v1:86757-86779 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1185489650 X:511488-511510 CCTGTCAGGGGGTTGGGGGAAGG + Intergenic
1186726262 X:12362354-12362376 CCTGTCATGGAGTGGGAGGAGGG - Intronic
1186763465 X:12747142-12747164 CCTGTCATGGGGTGGGGGGAAGG + Intergenic
1186991030 X:15068065-15068087 CCTGTCAGGGGGTAGGGGGAGGG + Intergenic
1187068012 X:15859946-15859968 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1187357333 X:18589288-18589310 CCTGTCATGGGGTTGGGGGAGGG - Intronic
1187421389 X:19137035-19137057 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1187681356 X:21770707-21770729 CCTGGCCAGAACTCGGGGGAAGG + Intergenic
1188017033 X:25117288-25117310 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1188097453 X:26042303-26042325 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1188178287 X:27021933-27021955 CCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1188296811 X:28459938-28459960 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1188354804 X:29177742-29177764 CCTGTCATGGGGTCGGGGGCTGG - Intronic
1188709368 X:33375760-33375782 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1188769489 X:34134474-34134496 CCTGTCATGGAGTGGGGGGATGG - Intergenic
1188951153 X:36376772-36376794 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1189018043 X:37304835-37304857 CCTGTCATGAGGTGGGGGGAGGG - Intergenic
1189043146 X:37563960-37563982 CCTGTCGTGCGGTGGGGGGAGGG + Intronic
1189051637 X:37651749-37651771 CCTGTCATGGGGTTGGGGGAGGG - Intronic
1189728648 X:43995374-43995396 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
1190053698 X:47170137-47170159 CCTGTCCAGCAGGCTGGGAAGGG + Intronic
1190210093 X:48439159-48439181 CCTGTCATGGGGTCGGGGGAGGG + Intergenic
1190397713 X:50001613-50001635 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1190410358 X:50131014-50131036 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1190540111 X:51468476-51468498 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1191175020 X:57490314-57490336 CCTGTCAGGGAGTGGGGGGAGGG - Intergenic
1191672996 X:63766393-63766415 CCAGCCAAGCAGTAGGGTGAGGG - Intronic
1191973886 X:66849113-66849135 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1192125738 X:68499172-68499194 CCCCTAAAGAAGTCGGGGGACGG + Intronic
1192160338 X:68781667-68781689 CCTGTCAGTCAGTGGGGGGCTGG + Intergenic
1192287134 X:69750170-69750192 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1192612807 X:72584899-72584921 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1192674191 X:73177347-73177369 CCTGTCGTGCGGTGGGGGGAGGG + Intergenic
1192820153 X:74636798-74636820 CCTGGCCAGAACTCGGGGGAGGG + Intergenic
1192870084 X:75176563-75176585 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1192951463 X:76021679-76021701 CCTGTCGTGCGGTGGGGGGAGGG + Intergenic
1193096245 X:77552455-77552477 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1193110666 X:77726466-77726488 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1193420749 X:81279829-81279851 CCTGGCCAGAACTCGGGGGAGGG + Intronic
1193657198 X:84212737-84212759 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1193800851 X:85934423-85934445 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1193937562 X:87641538-87641560 CCTGGCCAGAAATCGGGGGAGGG + Intronic
1194628491 X:96254359-96254381 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1194632603 X:96303733-96303755 CCTGTCATGGGGTTGGGGGAGGG + Intergenic
1195133118 X:101874402-101874424 CCTGTCGTGCGGTTGGGGGATGG + Intergenic
1195368742 X:104152225-104152247 CCTGTCATGGGGTGGGGGGAGGG - Intronic
1195552455 X:106184827-106184849 CCCTTCAAGCTGTAGGGGGAAGG - Intronic
1195660823 X:107376195-107376217 CCTGTCAGGGGGTGGGGGGAGGG - Intergenic
1195795395 X:108641885-108641907 CCTGGCCAGAACTCGGGGGAGGG + Intronic
1196079313 X:111614498-111614520 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1196127422 X:112114607-112114629 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1196296128 X:113999335-113999357 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1196419454 X:115507436-115507458 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1196459525 X:115915976-115915998 CCTGTCACGGGGTGGGGGGACGG + Intergenic
1196471473 X:116033364-116033386 CCTGTCATGTGGTGGGGGGAGGG + Intergenic
1196488918 X:116245690-116245712 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1196662014 X:118279731-118279753 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1196854141 X:119967193-119967215 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1197513336 X:127397201-127397223 CCCTTCAAGCAGTAGGGGGAGGG + Intergenic
1197575419 X:128204913-128204935 CCTGTCACGGGGTGGGGGGAGGG + Intergenic
1197576356 X:128216937-128216959 CCTGTCAGGGAGTGGGGGGCTGG + Intergenic
1197711251 X:129670901-129670923 CCTGTCGTGGAGTTGGGGGAGGG - Intergenic
1197898590 X:131343640-131343662 CCTGTCGTGGAGTGGGGGGAGGG - Intronic
1198192785 X:134326722-134326744 CCTGTCAAGGGGTAGGGGGAAGG + Intergenic
1198587819 X:138142331-138142353 CCTGTCATGGGGTGGGGGGATGG - Intergenic
1199120938 X:144053308-144053330 CCTGTCAGGCGGTGGGGGGCTGG - Intergenic
1199468237 X:148164548-148164570 CCTGTCATGGGGTGGGGGGAGGG + Intergenic
1199475545 X:148240932-148240954 CCTGTCATGGGGTGGGGGGATGG + Intergenic
1199570963 X:149266764-149266786 CCTGTCGTGGGGTCGGGGGAGGG + Intergenic
1200294937 X:154910414-154910436 CCTGTCATGGGGTGGGGGGAGGG + Intronic
1200776157 Y:7171977-7171999 CCCTTCAAGCTGTAGGGGGAGGG + Intergenic
1200801088 Y:7387682-7387704 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1200880863 Y:8210202-8210224 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1201302214 Y:12518552-12518574 CCTGTCATGGGGTGGGGGGAGGG - Intergenic
1201407572 Y:13664163-13664185 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1201487511 Y:14508509-14508531 CCCTTCAAGCTGTAGGGGGAAGG + Intergenic
1201516040 Y:14819520-14819542 CCCTTCAAGCTGTCAGGGGAGGG - Intronic
1201602097 Y:15742498-15742520 CCTGTCATGGGGTCGGGGGAGGG - Intergenic
1201690316 Y:16757107-16757129 CCTGTCATGGGGTTGGGGGAGGG - Intergenic
1201916313 Y:19185276-19185298 CCTGTTGTGCAGTGGGGGGAAGG - Intergenic
1202074761 Y:21026910-21026932 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic
1202146754 Y:21806702-21806724 CCCTTCAAGCTGTAGGGGGAGGG - Intergenic